ID: 1186374326

View in Genome Browser
Species Human (GRCh38)
Location X:8981944-8981966
Sequence CATCTGTAGCAGCTAAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186374326_1186374328 -1 Left 1186374326 X:8981944-8981966 CCGAGCTTTAGCTGCTACAGATG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1186374328 X:8981966-8981988 GTCTTTGGTTTCTGTTTCTTTGG 0: 1
1: 1
2: 4
3: 90
4: 958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186374326 Original CRISPR CATCTGTAGCAGCTAAAGCT CGG (reversed) Intergenic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
904774641 1:32899277-32899299 CATCAGAAGCAGCTAAAGAAGGG - Intronic
905280540 1:36846334-36846356 CATCTTTAGCACCTAACGCTGGG + Intronic
905522715 1:38612837-38612859 CATCTGGACCAGCCAAACCTAGG - Intergenic
906265587 1:44426378-44426400 GATCTTTAGAAGTTAAAGCTGGG + Intronic
907611970 1:55880165-55880187 CATCTATAGCACCTGAAACTTGG + Intergenic
908710444 1:67008430-67008452 CCTCTGTGGCAGATACAGCTGGG + Intronic
911912015 1:103649185-103649207 CATCTGTAGGAACTAATTCTTGG + Intergenic
911916439 1:103702763-103702785 CATCTGTAGGAACTAATTCTTGG - Intronic
911919430 1:103743323-103743345 CATCTGTAGGAACTAATTCTTGG + Intronic
913360362 1:117973885-117973907 CTTCAGTAGGAGCTAAATCTTGG - Intronic
913600385 1:120415972-120415994 CAGCTCTAGCAGCAAAAGATAGG - Intergenic
914086669 1:144460671-144460693 CAGCTCTAGCAGCAAAAGATAGG + Intronic
914192564 1:145424604-145424626 CAGCTCTAGCAGCAAAAGATAGG + Intergenic
914293699 1:146298587-146298609 TATCTGGAAAAGCTAAAGCTGGG + Intergenic
914554743 1:148749370-148749392 TATCTGGAAAAGCTAAAGCTGGG + Intergenic
914590475 1:149102557-149102579 CAGCTCTAGCAGCAAAAGATAGG + Intronic
914747412 1:150510447-150510469 CATCTCTAGCAGAGAAAGCCTGG - Intronic
917489462 1:175485605-175485627 CATGTGTGGCAGGAAAAGCTGGG - Intronic
918345307 1:183602592-183602614 CATCTAAGGAAGCTAAAGCTTGG + Intergenic
918386767 1:184015859-184015881 CATCTATGGCATCTACAGCTGGG - Intronic
918667685 1:187172173-187172195 CATTTTTAGCACCTAATGCTGGG + Intergenic
1063540886 10:6932652-6932674 CATCTGTAGAAGATCAAGCAAGG - Intergenic
1063556869 10:7088793-7088815 CTTCTGTTGCAGCTAGAGCATGG + Intergenic
1068746950 10:60543369-60543391 CATTTGTAAAAGCTAAAGATTGG + Intronic
1069620224 10:69832901-69832923 CATTTGTAGCAGCTGTAGTTGGG + Intronic
1072472269 10:95723724-95723746 GATCTGAACCAGCTAATGCTGGG + Intronic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1074608440 10:114997509-114997531 CATTTGTAGCAGGTAAAGGGAGG + Intergenic
1078701118 11:13683873-13683895 AATGTGTAGCAGCTAAAACATGG + Intronic
1079022214 11:16918425-16918447 CAACTGAAGCAGCCCAAGCTGGG + Intronic
1080237008 11:30081774-30081796 CAACTGTAGAAGCTAAAATTGGG + Intergenic
1082686930 11:56250053-56250075 CATGTTTAGCAGCATAAGCTTGG - Intergenic
1085018126 11:73188585-73188607 CATCTTTTGCAGCCAAAGGTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1090884030 11:130860728-130860750 GATCTGTAGGGTCTAAAGCTAGG - Intergenic
1091952574 12:4607227-4607249 TATCTGTAGAAGGCAAAGCTTGG + Intronic
1095286211 12:40413780-40413802 CATCTGGAACAGATAAATCTTGG + Intronic
1098138186 12:67425096-67425118 CATCTGTAGCTGGTAAAACCAGG - Intergenic
1098478215 12:70930268-70930290 CATATGTAGAAGCTAAAGTATGG - Intergenic
1099603933 12:84777820-84777842 CATAGGTAACTGCTAAAGCTGGG + Intergenic
1100273869 12:93052830-93052852 CATATCTAGCAGCCAAATCTTGG - Intergenic
1100311514 12:93399251-93399273 TATCTGGAAAAGCTAAAGCTGGG + Exonic
1101645723 12:106629282-106629304 TGTCTGTAGCAGCAAAAGTTTGG - Intronic
1102198656 12:111042340-111042362 CATCTGTAGCAGCAAGGCCTAGG - Intronic
1104689161 12:130811924-130811946 CACCTGAATCAGATAAAGCTTGG + Intronic
1104915697 12:132263333-132263355 CATCTGTAGAGGAAAAAGCTTGG + Intronic
1106407685 13:29488052-29488074 CATCTGCAGCAGGAAAGGCTCGG - Intronic
1107814040 13:44228374-44228396 CATATGTTGCAGGTAGAGCTAGG - Intergenic
1108709844 13:53022226-53022248 CATCTGTATAATCTAAAACTGGG - Intergenic
1110262125 13:73497328-73497350 CAGTTGTAGAAGCTAAAGCTAGG - Intergenic
1111462092 13:88558694-88558716 CATCTGTAGCAGATAAACCAGGG - Intergenic
1114490485 14:23098048-23098070 CAGCTGTAGCAGCCACTGCTTGG - Exonic
1115972393 14:38960474-38960496 CATCTGAAGATGCTAAAGGTAGG + Intergenic
1117081397 14:52155854-52155876 CATCTGGAGCAACTCCAGCTAGG - Intergenic
1118697394 14:68398131-68398153 CAGCTGGGACAGCTAAAGCTGGG + Intronic
1121903073 14:97712159-97712181 CATCTGTGGCAGGTAACCCTAGG + Intergenic
1122476771 14:102015547-102015569 CATTTGTAGCTGCTACAGCTGGG - Intronic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1135518940 16:23158674-23158696 CATCAGATGCAGCAAAAGCTGGG - Intergenic
1136119875 16:28125887-28125909 TATCTGTAGTATCTAAAGCGTGG - Intronic
1138943096 16:61813768-61813790 ATTATGTTGCAGCTAAAGCTGGG - Intronic
1140715880 16:77724981-77725003 ATTCTGTTGCTGCTAAAGCTTGG + Intronic
1145779644 17:27553791-27553813 AGTCTGTAGGAGCTGAAGCTGGG - Intronic
1146737203 17:35248694-35248716 CATCTGTAGAATTTAAACCTTGG + Intronic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1158103118 18:53853493-53853515 TATCTGTGATAGCTAAAGCTTGG - Intergenic
1158808565 18:61004544-61004566 CATCTGGAGCAGCTAGAGTTTGG + Intergenic
1159146457 18:64460232-64460254 TATCAGTAGGAGCTAAACCTTGG + Intergenic
1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG + Intergenic
925189572 2:1871889-1871911 CCTCTGTTGCAGCTTCAGCTTGG - Intronic
934882913 2:97998666-97998688 CAGCTGTAGCAGCAACACCTGGG + Intergenic
935490099 2:103708814-103708836 CATTTGTAGTGGATAAAGCTAGG - Intergenic
940714679 2:157206827-157206849 CATCTGTAATAGCTAAAACCTGG - Intergenic
941329916 2:164167437-164167459 CATCTCTAGAAGTTAAAGTTGGG + Intergenic
942097221 2:172545062-172545084 CCTCTGTAGCAGCTAAAAGTTGG - Intergenic
945158234 2:206861546-206861568 CATCTATGGAAGCAAAAGCTGGG + Intergenic
945882157 2:215336721-215336743 TATTTGTAGTAGCTAAAGATTGG - Intronic
946067661 2:217003132-217003154 AATCTGTAGAATCTAAAGCAGGG + Intergenic
948653738 2:239464428-239464450 CATCTGTAGAAGATAATGATGGG - Intergenic
948841832 2:240654769-240654791 TCTCTGTAGAAGCTACAGCTGGG + Intergenic
1169132076 20:3171472-3171494 AAGCTGCAGCAGCCAAAGCTTGG - Intronic
1170093838 20:12622620-12622642 ATGCTGTAGCAGCTAAAGTTGGG + Intergenic
1170972249 20:21126426-21126448 CGTCAATAGCAGCTAAAGCCTGG + Intronic
1171773006 20:29340903-29340925 CATCTCTAGAAGTTCAAGCTGGG - Intergenic
1175739250 20:61409090-61409112 CATCTGTGCCAGCCCAAGCTGGG - Intronic
1177414731 21:20779081-20779103 CCTCTGTAGCAACAAAAGCTAGG + Intergenic
1179081771 21:38178297-38178319 CATCTGCAGCAGCAAGAGCAGGG - Intronic
1182615221 22:31583864-31583886 CCTGTGCAGCAGCTAAAGCAAGG - Exonic
949394531 3:3600802-3600824 CATCTTTAGCAGTTCATGCTGGG - Intergenic
954990126 3:54833471-54833493 CCTCAGTAGCAGCTACAGGTTGG + Intronic
956487103 3:69734470-69734492 CATCTTTTGCAGTTAAGGCTTGG + Intergenic
957308955 3:78494499-78494521 CTTGTCTAGCAGCTAAAGCATGG - Intergenic
957876903 3:86158444-86158466 CATATGTAGTAGCTAAAAGTGGG + Intergenic
966465812 3:180230039-180230061 CCTCTGTAGCATCCAAAGCCAGG - Intergenic
972774305 4:42227382-42227404 CATCTGCACCATCTAAACCTGGG - Intergenic
975044790 4:69788238-69788260 ATTCTGTAGCATCTAAAGCAAGG - Intergenic
983444105 4:167826721-167826743 CATTTTTAGCAGCAAAAGCTTGG - Intergenic
984974656 4:185219728-185219750 TATGTGTAGCAGCTCAAGGTTGG - Intronic
985493285 5:191462-191484 CAGCTGCTGCAGCTAAAGATAGG + Intergenic
988545495 5:32153041-32153063 TATCTGTAGGAGCAAAAGTTTGG + Intronic
989257036 5:39377035-39377057 CATCTGTGGCACCCAATGCTTGG - Exonic
991667893 5:69017912-69017934 CAGCAGGAGCATCTAAAGCTGGG - Intergenic
992298168 5:75347785-75347807 CATGTGTTGAAGCTAATGCTGGG - Intronic
993144057 5:84071259-84071281 CATTTGTAGTAGCTGAAGCTGGG + Intronic
998200961 5:140120100-140120122 CATCTGTAGCAACTTAGGTTTGG + Exonic
998555636 5:143120866-143120888 CATCTGTAGGAGCCAGAACTTGG - Intronic
999259947 5:150232165-150232187 CATCTGTCTAAGCTGAAGCTTGG - Intronic
1002465487 5:179406232-179406254 CAGCTGTTGCTGGTAAAGCTGGG + Intergenic
1004995249 6:21184770-21184792 CCTCTGGAGTAGCTATAGCTAGG + Intronic
1006163468 6:32050897-32050919 CATCTGTGGGGGCTAAAGATGGG - Intronic
1006164091 6:32054286-32054308 CATCCGTGGGAGCTAAAGATGGG - Intronic
1007933277 6:45711279-45711301 CAGCTGTAGGTGCTAGAGCTGGG - Intergenic
1008224353 6:48895158-48895180 CATCAGTAGAAACTAAAACTAGG + Intergenic
1010541461 6:77097185-77097207 CCTCTGTAGCAGCCAAAGCTTGG - Intergenic
1011419934 6:87160530-87160552 CCTCTGTAACATCTAAACCTAGG - Intronic
1014174922 6:118321755-118321777 CATCTGTAACTGCTGAAGCCGGG + Intergenic
1015366937 6:132406420-132406442 CGTATATAGAAGCTAAAGCTTGG - Intergenic
1015785248 6:136916591-136916613 CATGTGTAGGAGTAAAAGCTGGG - Intergenic
1018896418 6:168021363-168021385 CCTCTGAAGCAGCGGAAGCTGGG - Intronic
1021421590 7:20450941-20450963 CACTTGTAGCTGCTAAAACTAGG - Intergenic
1022227264 7:28376140-28376162 CATCTGCAGCAGCTGATGATTGG - Intronic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1038676036 8:29623856-29623878 CCTCTGCAGCTGCTAAAGGTAGG + Intergenic
1038945380 8:32353886-32353908 TATCTGTAACAGCTAAAAGTTGG + Intronic
1045499981 8:102737912-102737934 GATCTGCAGCAGCTCAGGCTCGG + Intergenic
1045869051 8:106904632-106904654 CATCTGAAGTAGGTGAAGCTTGG - Intergenic
1047545889 8:125816047-125816069 TTTCTATAGCAGCTAATGCTGGG - Intergenic
1048752617 8:137697292-137697314 CATCTGTGGCAGCTAAACTTGGG + Intergenic
1048986821 8:139739193-139739215 CACCGGCAGCAGCTCAAGCTGGG + Intronic
1052216414 9:25971992-25972014 CATCTCTACCAGCTGAATCTGGG - Intergenic
1054916919 9:70503118-70503140 CATATGTATAAGCTGAAGCTAGG + Intergenic
1056278351 9:85015402-85015424 CATCTGTCTCATCTAAGGCTTGG + Intronic
1057310567 9:93940513-93940535 CATCTCTGGCAGCTGACGCTAGG + Intergenic
1057977070 9:99617013-99617035 TAAGTGCAGCAGCTAAAGCTGGG + Intergenic
1058380602 9:104372961-104372983 CATCTGTATCAACTAAAAGTAGG + Intergenic
1059362811 9:113759005-113759027 CAGCTGTAGCAGCCACTGCTTGG + Intergenic
1061901090 9:133672469-133672491 CTTCTGAAACAGATAAAGCTGGG - Intronic
1186374326 X:8981944-8981966 CATCTGTAGCAGCTAAAGCTCGG - Intergenic
1188853316 X:35159157-35159179 CATATGCAGAAGCTAAAACTCGG - Intergenic
1189774383 X:44457085-44457107 CATCTGCAGCAGCTAGAGGATGG + Intergenic
1190526468 X:51333380-51333402 TATCTGGAGAAACTAAAGCTGGG + Exonic
1190542773 X:51496008-51496030 TATCTGGAGAAACTAAAGCTGGG - Exonic
1193417207 X:81238982-81239004 CTTCTGAAGCAGCTGCAGCTTGG + Intronic
1194605700 X:95975287-95975309 CCTCTGTAGCATATATAGCTAGG + Intergenic
1195925631 X:110021912-110021934 CATCTGGACCTGCTAAAGTTTGG + Intronic
1200253761 X:154568378-154568400 CATTTGTAGCTGCCAAAGGTCGG + Intergenic
1200264008 X:154636030-154636052 CATTTGTAGCTGCCAAAGGTCGG - Intergenic
1201912604 Y:19148008-19148030 CATGTGTAGAAGCTCAAACTTGG + Intergenic