ID: 1186375955

View in Genome Browser
Species Human (GRCh38)
Location X:9001680-9001702
Sequence TTTAGGACTACAATCCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186375955_1186375958 25 Left 1186375955 X:9001680-9001702 CCCAAATGGATTGTAGTCCTAAA No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186375955 Original CRISPR TTTAGGACTACAATCCATTT GGG (reversed) Intergenic
No off target data available for this crispr