ID: 1186375956

View in Genome Browser
Species Human (GRCh38)
Location X:9001681-9001703
Sequence ATTTAGGACTACAATCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186375956_1186375958 24 Left 1186375956 X:9001681-9001703 CCAAATGGATTGTAGTCCTAAAT No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186375956 Original CRISPR ATTTAGGACTACAATCCATT TGG (reversed) Intergenic