ID: 1186375957

View in Genome Browser
Species Human (GRCh38)
Location X:9001697-9001719
Sequence GATCATGTGCTTTTATATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186375957_1186375958 8 Left 1186375957 X:9001697-9001719 CCTAAATATAAAAGCACATGATC No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data
1186375957_1186375959 16 Left 1186375957 X:9001697-9001719 CCTAAATATAAAAGCACATGATC No data
Right 1186375959 X:9001736-9001758 CTTATTACATTTAGGTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186375957 Original CRISPR GATCATGTGCTTTTATATTT AGG (reversed) Intergenic