ID: 1186375958

View in Genome Browser
Species Human (GRCh38)
Location X:9001728-9001750
Sequence ATGCAGAGCTTATTACATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186375956_1186375958 24 Left 1186375956 X:9001681-9001703 CCAAATGGATTGTAGTCCTAAAT No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data
1186375955_1186375958 25 Left 1186375955 X:9001680-9001702 CCCAAATGGATTGTAGTCCTAAA No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data
1186375957_1186375958 8 Left 1186375957 X:9001697-9001719 CCTAAATATAAAAGCACATGATC No data
Right 1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186375958 Original CRISPR ATGCAGAGCTTATTACATTT AGG Intergenic
No off target data available for this crispr