ID: 1186375959 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:9001736-9001758 |
| Sequence | CTTATTACATTTAGGTTTAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1186375957_1186375959 | 16 | Left | 1186375957 | X:9001697-9001719 | CCTAAATATAAAAGCACATGATC | No data | ||
| Right | 1186375959 | X:9001736-9001758 | CTTATTACATTTAGGTTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1186375959 | Original CRISPR | CTTATTACATTTAGGTTTAA TGG | Intergenic | ||