ID: 1186381098

View in Genome Browser
Species Human (GRCh38)
Location X:9060070-9060092
Sequence CGATAGGAGTGGATCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186381098 Original CRISPR CGATAGGAGTGGATCACAGG TGG (reversed) Intronic
900641565 1:3690247-3690269 GGAGAGGAGGGGCTCACAGGAGG - Intronic
900927237 1:5713295-5713317 AGATAGGAGGGGTTCCCAGGCGG - Intergenic
904303571 1:29572116-29572138 CGAGAGGAGTGGATAACAATAGG + Intergenic
907044427 1:51291256-51291278 CGAGATGAGTGGATCACCTGAGG + Intronic
907469617 1:54664778-54664800 TGAGACGAGTGGATCACTGGAGG + Intronic
907551193 1:55306120-55306142 TGATAGGAGAGATTCACAGGGGG + Intergenic
908861462 1:68494908-68494930 CGATGCGGGTGGATCACCGGAGG + Intronic
908940713 1:69430263-69430285 CGAGATGGGTGGATCACTGGAGG + Intergenic
910453757 1:87373466-87373488 CGATGGGGGTGGATCACCTGAGG - Intergenic
910835442 1:91504337-91504359 AGATAGGAGGGGATCACTTGAGG - Intronic
911286844 1:96005387-96005409 CCATAGTAGTGGATCAGAGTTGG - Intergenic
911513903 1:98843532-98843554 AGAGGCGAGTGGATCACAGGAGG - Intergenic
912437762 1:109673829-109673851 CGAGACGAGTGGATCACCTGAGG - Intronic
917840381 1:178972808-178972830 CGAGATGGGTGGATCACATGAGG + Intergenic
918387155 1:184021087-184021109 CTATAGGAGTGAATACCAGGAGG + Intronic
918805312 1:189033303-189033325 CAATAGGCATGGATTACAGGGGG + Intergenic
919546215 1:198922455-198922477 TGAGATGAGTGGATCACTGGAGG - Intergenic
920190546 1:204190856-204190878 GGATAGGATGGGATGACAGGAGG - Intronic
921102104 1:211937356-211937378 CGATGGGGGTGGATCACTGGAGG + Intergenic
922979003 1:229809233-229809255 GGGGAGTAGTGGATCACAGGGGG + Intergenic
924061638 1:240181234-240181256 CGAGGGGAGTGGATCACCTGAGG - Intronic
924198244 1:241632713-241632735 TGATAGGAATGAATCAAAGGAGG - Exonic
1062870035 10:893144-893166 CGAGGGGGGTGGATCACATGAGG - Intronic
1063969583 10:11372196-11372218 CTACAGGAGAGGCTCACAGGAGG + Intergenic
1065501393 10:26386080-26386102 CGAGGGGGGTGGATCACATGAGG - Intergenic
1065582953 10:27190050-27190072 TGAGACGAGTGGATCACAGGAGG + Intergenic
1069937009 10:71924488-71924510 CGAGAGGATTGGATTGCAGGAGG - Intergenic
1071851219 10:89572489-89572511 CGATACGGGTGGATCACCTGAGG - Intergenic
1074006741 10:109433474-109433496 GAATAGGATTGGAACACAGGAGG - Intergenic
1074512584 10:114129760-114129782 CGAGATGAGTGGATCACCTGAGG - Intronic
1074941360 10:118238808-118238830 GGATGGGAGTGGTTCACAGATGG - Intergenic
1079058348 11:17226804-17226826 CGAAATGAGTGGATCACTTGAGG - Intronic
1080566036 11:33510417-33510439 CGAGACGAGTGGATCACTTGAGG - Intergenic
1084973771 11:72785330-72785352 CGATACGGGTGGATCACCTGAGG + Intronic
1088935160 11:114392303-114392325 CGAGGCGAGTGGATCACTGGAGG + Intronic
1089247407 11:117132239-117132261 CGAGGGGGGTGGATCACATGAGG + Intergenic
1089529814 11:119120290-119120312 CGAGGCGAGTGGATCACATGAGG - Intergenic
1089995401 11:122902222-122902244 TGAAGCGAGTGGATCACAGGAGG + Intronic
1090779167 11:129991584-129991606 CGAGAGGGGTGGATCACCTGAGG + Intronic
1092833772 12:12469118-12469140 CGAGACGAGTGGATCACCTGAGG + Exonic
1094632870 12:32194647-32194669 CGAGGGGGGTGGATCACATGAGG + Intronic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1095149584 12:38776540-38776562 CGAGGGGAGCGGATCACTGGAGG - Intronic
1096311098 12:50521726-50521748 CGGTTGGAGTGGATCACTTGAGG - Intronic
1099597984 12:84693007-84693029 CGAGAGGGGTGGATCACTTGAGG + Intergenic
1099988556 12:89698101-89698123 AGATATGAGTGGATCACTTGAGG - Intronic
1100488058 12:95050539-95050561 CGAGAGGGGTGGATCACCTGAGG - Intronic
1100492301 12:95092986-95093008 CGAGTCGAGTGGATCACATGAGG + Intronic
1101619651 12:106372571-106372593 CGAGGCGAGTGGATCACATGAGG - Intronic
1101853595 12:108424015-108424037 CGAGAGGGGTGGATCACCTGAGG - Intergenic
1101976415 12:109363478-109363500 CGAGACGAGTGGATCACTTGAGG + Intronic
1104722215 12:131050897-131050919 TGATAGGAGGGGAGCTCAGGTGG + Intronic
1105845828 13:24292763-24292785 CGAAACGGGTGGATCACATGAGG + Intronic
1106139284 13:26998139-26998161 CGAGATGAGTGGATCACTTGAGG - Intergenic
1107115988 13:36745850-36745872 CCACAGGAGAGGATCACAAGAGG + Intergenic
1107818433 13:44265207-44265229 CGATGCGAGTGGATCACTTGAGG + Intergenic
1108614197 13:52115370-52115392 CGAGATGAGTGGATCACCTGAGG + Intronic
1108624897 13:52218179-52218201 CGAGACGGGTGGATCACTGGAGG + Intergenic
1108661156 13:52588238-52588260 CGAGACGGGTGGATCACTGGAGG - Intergenic
1113727021 13:112612417-112612439 CGATGGGGGTGGATCACCTGAGG + Intergenic
1113733695 13:112660483-112660505 CGAGGGGAGTGGATCACCTGAGG - Intronic
1114501182 14:23169969-23169991 CAATGGGAATGGTTCACAGGAGG + Intronic
1116077414 14:40128274-40128296 CGAGATGAGTGGATCACTTGAGG - Intergenic
1116802145 14:49454187-49454209 GGATAGGAGTGGAGTAAAGGGGG - Intergenic
1117404646 14:55390301-55390323 CGAGGGGAGTGGATCACCTGAGG - Intronic
1118144967 14:63125122-63125144 CGACAGGGGTGGATCACCTGAGG + Intergenic
1118182983 14:63511844-63511866 CGAGGTGAGTGGATCACATGAGG + Intronic
1120430746 14:84411436-84411458 CGAGGTGGGTGGATCACAGGAGG + Intergenic
1124358955 15:29020571-29020593 CGAGAGGGGTGGATCACCTGAGG + Intronic
1126013486 15:44326882-44326904 CGAGAAGGGTGGATCACATGAGG - Intronic
1126955701 15:53931399-53931421 CGAGAAGAGTGGATCACTTGAGG - Intergenic
1127835533 15:62788076-62788098 CGAGATGAGTGGATCACTTGAGG + Intronic
1129543725 15:76373278-76373300 CGAGACGAGTGGATCACCTGAGG - Intronic
1130450008 15:84041974-84041996 CGAGTGGGGTGGATCACATGAGG - Intergenic
1131140062 15:89970044-89970066 CGAGACGAGTGGATCACCTGAGG + Intergenic
1131638459 15:94262901-94262923 TGAGATGGGTGGATCACAGGAGG - Intronic
1132043107 15:98541784-98541806 CGAGACGAGTGGATCACTTGAGG + Intergenic
1132321997 15:100932216-100932238 CGAGACGAGTGGATCACTTGAGG - Intronic
1132648169 16:1008543-1008565 GGAGAGGAGAGGCTCACAGGAGG - Intergenic
1134126516 16:11619933-11619955 CGAGAGCAGTGGATCACCTGAGG + Intronic
1136418228 16:30116405-30116427 TGAGAGGAGTGGATCACCTGAGG - Intronic
1136497771 16:30654602-30654624 GGAAAGGAGAGGGTCACAGGTGG - Intronic
1137621558 16:49879843-49879865 CAATAGCAGTCAATCACAGGTGG - Intergenic
1139479225 16:67219665-67219687 CGAGACGAGTGGATCACCTGAGG - Intronic
1139703965 16:68727541-68727563 CGAGACGAGTGGATCACTTGAGG + Intergenic
1141130243 16:81431584-81431606 CAATAGCAGTGGTTGACAGGTGG - Intergenic
1141859233 16:86705156-86705178 CGATGCGAGTGGATCACCTGAGG + Intergenic
1141881693 16:86864487-86864509 CGATGGGGGTGGATCACCTGAGG - Intergenic
1141975233 16:87511270-87511292 CGAGGGGAGTGGATCACCTGAGG + Intergenic
1142672944 17:1495796-1495818 GGATGGGAGTGAATCCCAGGCGG - Exonic
1143154948 17:4830618-4830640 CGAGACGAGTGGATCACCTGAGG - Intergenic
1143154993 17:4830922-4830944 CGAGACGAGTGGATCACCTGAGG - Intergenic
1146314712 17:31797882-31797904 CGATGGGGGTGGATCACTTGCGG - Intergenic
1148465430 17:47862111-47862133 CAAGATGAGTGGATCACCGGAGG + Intergenic
1148769794 17:50060177-50060199 GGATAGGAGGGGAACACAGGAGG + Intronic
1150037594 17:61820715-61820737 CGAGGGGAGTGGATCACTTGAGG + Intronic
1150073100 17:62169225-62169247 CGAGATGAGTGGATCACCTGAGG - Intergenic
1150819600 17:68424641-68424663 CGAGACGAGTGGATCACTTGAGG + Intronic
1151626052 17:75276598-75276620 CGAGACGAGTGGATCACCTGAGG - Intronic
1152039997 17:77896978-77897000 CGAGACGGGTGGATCACATGAGG - Intergenic
1152392055 17:80009046-80009068 CGATAGCAGGGGATAATAGGAGG + Intronic
1153234063 18:2968830-2968852 CGACAGGATTAGGTCACAGGGGG + Intronic
1157048544 18:44132632-44132654 CGATGGGGGTGGATCACCTGAGG + Intergenic
1157822958 18:50787345-50787367 CGAGATGAGTGGATCACTGAAGG + Intergenic
1158993568 18:62894427-62894449 CGAGATGAGTGGATCACTTGAGG - Intronic
1160210447 18:76873951-76873973 CGACAGGAGAGGAGGACAGGCGG - Intronic
1161193612 19:2973695-2973717 CGAGATGAGTGGATCACTTGAGG + Intergenic
1161555313 19:4938639-4938661 CGAGACGAGTGGATCACCTGAGG - Intronic
1163818108 19:19480037-19480059 CGAGGCGGGTGGATCACAGGAGG - Intronic
1164041806 19:21499226-21499248 CGAGGGGAGTGGATCACCTGAGG + Intronic
1165165573 19:33852087-33852109 TGAGAGGAGTGGATCACCTGAGG + Intergenic
1166154759 19:40902611-40902633 CGAGATGAGTGGATCACCTGAGG - Intergenic
1167107792 19:47440821-47440843 CGAGGAGAGTGGATCACCGGAGG - Intronic
1167641363 19:50684140-50684162 GGATAGAAGAAGATCACAGGAGG + Intronic
927803775 2:26126343-26126365 CGATGGGGGTGGATCACTTGAGG + Intronic
928098469 2:28420484-28420506 CGAGACGAGTGGATCACCTGAGG - Intergenic
930795611 2:55386940-55386962 CGAGGCGGGTGGATCACAGGAGG + Intronic
932133752 2:69210701-69210723 CGACAGGGGTGGATCACTTGAGG + Intronic
932578574 2:72977740-72977762 CGATGTGAGTGGATCACTTGAGG + Intronic
933678998 2:85082136-85082158 CGATGGGAGGGGATTACATGAGG + Intergenic
934147374 2:89108706-89108728 CGAGATGGGTGGATCACCGGAGG - Intergenic
940312113 2:152290047-152290069 CGAGATGGGTGGATCACATGAGG - Intergenic
941586115 2:167361839-167361861 CGAGACGGGTGGATCACATGAGG + Intergenic
942345478 2:174998068-174998090 CGAGATGGGTGGATCACATGAGG + Intronic
943967370 2:194354123-194354145 CTATGGTAGTGGAGCACAGGGGG + Intergenic
945646113 2:212496945-212496967 CGATGGGGGTGGATCACCTGAGG + Intronic
946619336 2:221544556-221544578 CGATACGCGTGGATCACCTGAGG - Intronic
947331944 2:229038007-229038029 CATTAGGAATGGATCACAGAAGG + Intronic
947457459 2:230268289-230268311 CGAGATGAGTGGATCACCTGAGG + Intronic
948064555 2:235067500-235067522 CGAGACGGGCGGATCACAGGAGG - Intergenic
948535344 2:238642264-238642286 CGATGTGAGTGGATCACCTGAGG + Intergenic
1168826094 20:815272-815294 GAGGAGGAGTGGATCACAGGAGG + Intergenic
1172885035 20:38225232-38225254 CGAGATGGGTGGATCACATGAGG - Intronic
1172945220 20:38682287-38682309 TGATTGGGGTGGATCACATGGGG + Intergenic
1173232871 20:41215019-41215041 CGAAACGAGTGGATCACTTGAGG + Intronic
1174936678 20:54878133-54878155 CGAGATGGGTGGATCACTGGAGG + Intergenic
1176378518 21:6099988-6100010 CGAGACGAGTGGATCACCTGAGG + Intergenic
1178081612 21:29072214-29072236 CTATAGTAGAGGATGACAGGAGG - Intronic
1179140673 21:38722359-38722381 CGAGACGAGTGGATCACCTGAGG + Intergenic
1179744957 21:43438248-43438270 CGAGACGAGTGGATCACCTGAGG - Intergenic
1182236369 22:28880052-28880074 GGATAGGAGTGGATGACAGGGGG + Intergenic
1183808189 22:40230522-40230544 CGATGTGAGTGGATCACTTGAGG - Intronic
950175941 3:10874460-10874482 TGATAGGAGTGGGCCACAGAGGG - Intronic
952364334 3:32661593-32661615 CGATGGGGGTGGATCACCTGAGG + Intergenic
952399023 3:32946783-32946805 CGAGGGGAGTGGATCACTTGAGG + Intergenic
954547402 3:51449437-51449459 CGAGATGAGTGGATCACCTGAGG - Intronic
957732171 3:84152496-84152518 CGAGGGGAGTGGATCACTTGAGG + Intergenic
960561807 3:119092560-119092582 TGAGAGGAGTGGATCACCTGAGG - Intronic
961145368 3:124588656-124588678 CGAGGGGAGTGGATCACTTGAGG - Intronic
961155785 3:124678342-124678364 GGGTGGGAGTGGATGACAGGTGG - Intronic
961242211 3:125420990-125421012 CGAGGCGAGTGGATCACATGAGG + Intergenic
961673896 3:128553337-128553359 CGACACGAGTGGATCACCTGAGG + Intergenic
964009551 3:151874408-151874430 CGAGATGAGTGGATCACCTGAGG - Intronic
966701595 3:182859469-182859491 AGCTAGGAGTGGAGCAAAGGGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968448591 4:664581-664603 CGAGGGGAGTGGATCACCTGAGG + Intronic
970234477 4:13944694-13944716 CGAAAGAATTGGATCACACGTGG + Intergenic
970533915 4:17009951-17009973 CGATCGGGGTGGATCACCTGAGG - Intergenic
972719021 4:41677175-41677197 CGATGTGAGTGGATCACCTGAGG + Intronic
973664862 4:53148775-53148797 CAATAGGAGAGGATCACTTGAGG + Intronic
973744395 4:53949012-53949034 CGAGATGAGTGGATCACTTGAGG + Intronic
976052267 4:81023176-81023198 CGAGACGGGTGGATCACATGAGG + Intergenic
977094660 4:92725066-92725088 CGAGAGGGGTGGATCACTTGAGG + Intronic
977667396 4:99656509-99656531 CGAGACGAGTGGATCACCTGAGG - Intergenic
978330025 4:107602459-107602481 CGAGATGAGTGGATCACCTGAGG - Intronic
978700846 4:111644177-111644199 TGAGACGAGTGGATCACATGAGG + Intergenic
979873051 4:125850713-125850735 CGATGGGGGTGGATCACCTGAGG - Intergenic
980119144 4:128709700-128709722 CGAGACGAGTGGATCACCTGAGG + Intergenic
982089583 4:151868749-151868771 CGAGAGGGGTGGATCACTTGAGG - Intergenic
982729393 4:158939743-158939765 CGAGATGAGTGGATCACCTGAGG + Intronic
982743575 4:159083168-159083190 CGATGCGAGTGGATCACCTGAGG + Intergenic
982861925 4:160463441-160463463 CGTGAGGAGTGGAGCACAGCAGG - Intergenic
984242481 4:177234334-177234356 CGAGACGGGTGGATCACATGAGG + Intergenic
984358143 4:178691983-178692005 CGAGACGAGTGGATCACCTGAGG + Intergenic
987953781 5:24710938-24710960 CGAGATGGGTGGATCACATGAGG + Intergenic
992663990 5:78987990-78988012 CGATGGGGGTGGATCACCTGAGG - Intergenic
994170785 5:96657862-96657884 CGAGGCGAGTGGATCACATGAGG + Intronic
994281503 5:97908900-97908922 CGAGATGAGTGGATCACTTGAGG - Intergenic
997948594 5:138223917-138223939 CTAGAGGAGTGGATCAGAGGAGG + Intergenic
997992119 5:138553204-138553226 CGAGGGGAGTGGATCACTTGAGG + Intergenic
998237716 5:140414011-140414033 CGAGGCGAGTGGATCACATGAGG - Intronic
998597490 5:143548169-143548191 CGAGATGGGTGGATCACCGGTGG - Intergenic
999161691 5:149506157-149506179 CGATGGGGGTGGATCACCTGAGG - Intronic
1002514765 5:179749491-179749513 CGAGATGAGTGGATCACTAGAGG - Intronic
1002517436 5:179769783-179769805 CGAGATGAGTGGATCACTTGAGG - Intronic
1004359505 6:14958615-14958637 CGAGAGGGGCGGATCACATGAGG - Intergenic
1005294402 6:24410954-24410976 CGAGAGGGGTGGATCACCTGAGG + Intronic
1007213457 6:40216790-40216812 AGATATGGGTGGACCACAGGAGG + Intergenic
1009633009 6:66224138-66224160 CGAAGCGAGTGGATCACATGAGG + Intergenic
1009653969 6:66515283-66515305 CTATAGCAGTGGATTACGGGTGG + Intergenic
1011276451 6:85636210-85636232 CGAAGCGAGTGGATCACCGGAGG + Intronic
1013227725 6:108132694-108132716 CGAGGGGAGTGGATCACCTGAGG - Intronic
1016773247 6:147875665-147875687 TGACAGGAGTGGAGCTCAGGCGG - Intergenic
1020535888 7:9398141-9398163 TTCTAGGAATGGATCACAGGTGG - Intergenic
1023457588 7:40358478-40358500 CGAGATGAGTGGATCACCTGAGG + Intronic
1023957728 7:44901004-44901026 CAAGATGAGTGGATCACTGGAGG + Intergenic
1024355186 7:48407239-48407261 CGAGAGAAGTGGATCACCTGAGG + Intronic
1026181888 7:68048825-68048847 CGAGATGAGTGGATCACCTGAGG - Intergenic
1026611825 7:71866910-71866932 CGAAATGAGTGGATCACTTGAGG + Intronic
1027139344 7:75646317-75646339 CGAGATGAGTGGATCACCTGAGG - Intronic
1027175004 7:75897636-75897658 CGAGGGGAGTGGATCACTTGAGG + Intergenic
1027380868 7:77607985-77608007 CGAGATGAGTGGATCACCTGAGG - Intronic
1029300344 7:99578072-99578094 GGATAGAAGTAGATGACAGGTGG + Intronic
1029920392 7:104256415-104256437 CGAGACGAGTGGATCACTTGAGG + Intergenic
1031107738 7:117566199-117566221 CGAGGTGGGTGGATCACAGGAGG + Intronic
1032882401 7:136103444-136103466 AGATTGGAGTGGTTGACAGGAGG - Intergenic
1033207457 7:139435255-139435277 CGAGGGGAGTGGATCACTTGAGG + Intergenic
1035613675 8:986890-986912 CGAGACGGGTGGATCACTGGAGG - Intergenic
1036787084 8:11695171-11695193 CGAGAGGGGTGGATCACCTGAGG + Intronic
1037578083 8:20226647-20226669 CGAGAAGAGTGGATCACTTGAGG - Intronic
1037697737 8:21241239-21241261 CGATACGGGTGGATCACCTGAGG + Intergenic
1038654279 8:29434886-29434908 TGATGGGAGTGGATCACCTGAGG + Intergenic
1039087476 8:33794225-33794247 CGAGAAGAGTGGATCACTGGAGG + Intergenic
1040505894 8:48047171-48047193 CGAAGGGAGTGGATCACCTGAGG - Intronic
1045385197 8:101665932-101665954 CCACAGGAGTAGGTCACAGGTGG + Intronic
1046623401 8:116551860-116551882 CGAGACGAGTGGATCACATGAGG - Intergenic
1047180084 8:122579141-122579163 CAATGGGAGGGGATCACAGAAGG + Intergenic
1049137261 8:140914801-140914823 CGAGGCGAGTGGATCACATGAGG + Intronic
1049610032 8:143550541-143550563 AGATAGGAGTGGGTCCCTGGTGG + Intergenic
1054930416 9:70629567-70629589 CGAGATGAGTGGATCACCTGAGG - Intronic
1057567655 9:96179474-96179496 CGAGACGAGTGGATCACCTGAGG + Intergenic
1059602822 9:115799811-115799833 GGAAAGGAGTGGATACCAGGTGG + Intergenic
1185588839 X:1260481-1260503 CGAGAGGGGTGGATCACTTGAGG - Intergenic
1186377745 X:9024912-9024934 CGAGGGGAGTGGATCACTTGAGG - Intronic
1186381098 X:9060070-9060092 CGATAGGAGTGGATCACAGGTGG - Intronic
1186383657 X:9087547-9087569 CGAGGCGAGTGGATCACATGAGG - Intronic
1186444858 X:9618441-9618463 CGAGACGGGTGGATCACATGAGG + Intronic
1187056085 X:15742604-15742626 CGGGAGGAGAGGATCACTGGAGG - Intronic
1187531863 X:20104531-20104553 CGAGAGGGGTGGATCACCTGAGG - Intronic
1188915768 X:35908545-35908567 CGATGTGGGTGGATCACTGGAGG - Intergenic
1189398300 X:40643006-40643028 CGAGACGAGTGGATCACTTGAGG - Intronic
1190244634 X:48683316-48683338 CGAGACGAGTGGATCACTTGAGG - Intronic
1192582237 X:72293905-72293927 CGACGGGGGTGGATCACATGAGG - Intronic
1195137536 X:101924342-101924364 CGAGATGAGTGGATCACCTGTGG - Intronic
1195324123 X:103744222-103744244 CGAGACGAGTGGATCACCTGAGG - Intergenic
1196836991 X:119822838-119822860 CGATATGGGTGGATCACCTGAGG - Intergenic
1198233624 X:134716238-134716260 CCCTAGGGGTGGGTCACAGGTGG - Intronic