ID: 1186384301

View in Genome Browser
Species Human (GRCh38)
Location X:9093596-9093618
Sequence ACTTTAAAGCAGGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186384301_1186384304 -6 Left 1186384301 X:9093596-9093618 CCCTGCAGCTCCTGCTTTAAAGT 0: 1
1: 0
2: 4
3: 26
4: 216
Right 1186384304 X:9093613-9093635 TAAAGTCCATAAATACACTAAGG 0: 1
1: 0
2: 9
3: 22
4: 197
1186384301_1186384306 8 Left 1186384301 X:9093596-9093618 CCCTGCAGCTCCTGCTTTAAAGT 0: 1
1: 0
2: 4
3: 26
4: 216
Right 1186384306 X:9093627-9093649 ACACTAAGGAAAAGTCCACCAGG 0: 1
1: 0
2: 2
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186384301 Original CRISPR ACTTTAAAGCAGGAGCTGCA GGG (reversed) Intronic
904414181 1:30345951-30345973 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
905489084 1:38329500-38329522 GCTTCAGAGCAGGAGCTGGAGGG - Intergenic
905631394 1:39521008-39521030 CCTGTGAAGTAGGAGCTGCAGGG + Intronic
905666360 1:39765163-39765185 CCTGTGAAGTAGGAGCTGCAGGG - Intronic
908208195 1:61872701-61872723 ACCTTAAAGCAGGAGCGTAAGGG - Intronic
908577882 1:65480378-65480400 TCTATGAACCAGGAGCTGCATGG + Intronic
909540998 1:76791328-76791350 TTTTCAAAGCAGGGGCTGCAGGG - Intergenic
909648602 1:77946972-77946994 ACTTTAAAGGAAGAGGTACAAGG - Intronic
910973659 1:92883100-92883122 TCTCTAAAGCAGCAGCAGCAAGG - Intronic
911450803 1:98058047-98058069 AGTTTAAGGCAGAAGCTTCAAGG + Intergenic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
912775391 1:112503422-112503444 ACTGTGTTGCAGGAGCTGCAAGG + Intronic
913056573 1:115167331-115167353 ACTCTAAGTCAGGAGCTGCTAGG - Intergenic
913582271 1:120238119-120238141 TCTTTAAAGCAGAAGGTGTAGGG - Intergenic
913625904 1:120660265-120660287 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
914564205 1:148849597-148849619 TCTTTAAAGCAGAAGGTGTAGGG - Intronic
914608621 1:149280642-149280664 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
922126660 1:222733161-222733183 ACTTTAATTCAGGAGGTGGAGGG - Exonic
923014217 1:230113394-230113416 AGTTTATACCTGGAGCTGCAGGG + Intronic
923362760 1:233228229-233228251 ACAATGAAGGAGGAGCTGCATGG - Intronic
923887627 1:238176822-238176844 ACATTAAAGTAGGAGCTAAAGGG - Intergenic
924428837 1:243979325-243979347 ACTGTACAGCAGAAGCTGCTTGG - Intergenic
1063112632 10:3049929-3049951 ACCTTAGAGCAGGAGCAGCAAGG + Intergenic
1066436282 10:35399091-35399113 ACTTGAAAGCATGAGCTGATTGG + Intronic
1068885826 10:62095996-62096018 ACATTAAACCAGAAGTTGCATGG - Exonic
1069249801 10:66254449-66254471 ACTTTAAAGTGGGAGCTTAAGGG - Intronic
1069907628 10:71741012-71741034 ACATTTAAACAGGGGCTGCATGG - Intronic
1070090730 10:73282496-73282518 ACATTAAAACAGGGTCTGCATGG + Intronic
1070813482 10:79309960-79309982 ACTTTGAAGGAGGATCTGCTTGG + Intronic
1071414443 10:85428070-85428092 ACATTTAAACAGGAGCTTCAAGG + Intergenic
1072282553 10:93880862-93880884 ACTTTAAGGCAGGAGCTTGAGGG + Intergenic
1075030771 10:119023375-119023397 TGTTTAAAGCAGGAGCTGCCTGG - Intergenic
1075560312 10:123463427-123463449 ACTCTAAAACAAGAGTTGCAGGG - Intergenic
1079603637 11:22341194-22341216 ACTTTCTTGCAGGATCTGCAGGG - Intronic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1081722572 11:45301158-45301180 ACCTTAAAAAAGGAGATGCAAGG - Intergenic
1081962605 11:47149299-47149321 ACTTCAAAGCAGGGGCGGCCGGG + Intronic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084506318 11:69570560-69570582 ACTTTAAACTAGGAGCTGGCAGG - Intergenic
1085241472 11:75059980-75060002 ACTTGGGATCAGGAGCTGCAAGG - Intergenic
1085958156 11:81426703-81426725 ATTTTAAAACAGCAGGTGCAAGG + Intergenic
1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092890046 12:12960888-12960910 AGATCAAAGCAGAAGCTGCAAGG - Intergenic
1095279612 12:40334896-40334918 ACTTTAAAGAAGGAGATACGTGG + Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1098279043 12:68844668-68844690 GCTTTAAAGCAGGAGCTTGTGGG + Exonic
1098440665 12:70513961-70513983 TATTTAAAGCAGGAGCAGGATGG + Intergenic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1101335458 12:103792332-103792354 AATTTAAAGCATTAACTGCAGGG + Intronic
1103094223 12:118119862-118119884 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1104231163 12:126885725-126885747 ACCTTAGAGCAGGAGCTTAAGGG - Intergenic
1105341057 13:19526418-19526440 ATTTTTAAGCTGGAGCTGGATGG - Intronic
1106155512 13:27151697-27151719 ACTTGAGACCAGGAGTTGCAAGG + Intronic
1106525762 13:30539997-30540019 ACTCTAATGCAGAAGCAGCAGGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1109157932 13:58934808-58934830 ACCTTAAGGCAGGAGCTTAAGGG + Intergenic
1111128289 13:83940970-83940992 AACTTAAAGCAGAAGCTGAAGGG - Intergenic
1112487278 13:99831319-99831341 ACCATTAATCAGGAGCTGCAAGG + Intronic
1112585866 13:100718121-100718143 GTTTTAAAGCAGCAGATGCAAGG - Intergenic
1112869572 13:103953535-103953557 ATTTTAAGGTAGTAGCTGCAGGG - Intergenic
1114347224 14:21808739-21808761 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
1114439736 14:22736632-22736654 ACCTTAATGCAGGAGCTGAAGGG - Intergenic
1114704490 14:24711465-24711487 AGTTTATTCCAGGAGCTGCAGGG - Intergenic
1115384246 14:32777150-32777172 ACTTAAAAGCAAGACCTGAAAGG + Intronic
1115702582 14:35969151-35969173 ACTTTAAAGCAAATGCTCCAGGG + Intergenic
1118406506 14:65429571-65429593 ACTTTAAAGCAGGCCAGGCATGG + Intronic
1123581109 15:21715550-21715572 ACAGCAAAGCAGGGGCTGCAGGG + Intergenic
1123617758 15:22158173-22158195 ACAGCAAAGCAGGGGCTGCAGGG + Intergenic
1124827219 15:33109616-33109638 ACTTATAAGCAAGAGCTACATGG + Intronic
1125445981 15:39756841-39756863 ATGTGAAAGCTGGAGCTGCAAGG - Intronic
1125446041 15:39758018-39758040 ATATGAAAGCTGGAGCTGCAAGG - Intronic
1127094225 15:55496837-55496859 ACTTGAAAGCAGCAAATGCAGGG + Intronic
1127774296 15:62253428-62253450 AGCTCAAAGCAGGGGCTGCACGG + Intergenic
1127921230 15:63495892-63495914 ACTCTAAAGCTGGCTCTGCAAGG - Intergenic
1128671399 15:69577013-69577035 ACAGTAAAGCAGCAGGTGCAGGG - Intergenic
1130134034 15:81166874-81166896 ACTGTACAGCAGGGGCTGCAGGG - Intronic
1130329518 15:82910432-82910454 ACCTTAAGGCAGGAGCTTGAGGG + Intronic
1130347462 15:83061591-83061613 ACACAAAAGCAGGAGCTGCCAGG - Intronic
1131172301 15:90187075-90187097 ACATTAAAGCAAGAGCCTCAAGG - Intronic
1131202687 15:90413469-90413491 AACTTAAAGCAGGAGCTTAAGGG + Intronic
1133587789 16:7212450-7212472 ACTCTAAAGCAGCATCTGCATGG - Intronic
1135269140 16:21053864-21053886 TTTTTAAAGGAGGAGCTGGAAGG + Intronic
1135992646 16:27227341-27227363 ACTTTACAGATGGAGCTGGAAGG + Intronic
1137603963 16:49774944-49774966 TCTTTAAGGCAGGATCTCCAAGG - Intronic
1138608261 16:58102794-58102816 ACACAAAAGCAGGAGCTGCTAGG + Intergenic
1138851477 16:60634564-60634586 ACCTTAAAGCAGGCGCTTTAGGG + Intergenic
1138868882 16:60856556-60856578 ACTTGAAAGCAGGAGAAGCCAGG + Intergenic
1140053014 16:71499496-71499518 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141920390 16:87131924-87131946 ACAGTGAAGCAGGAGGTGCAGGG + Intronic
1145901687 17:28494138-28494160 ACTTGAAGGCAGGGGCTGCCCGG - Intronic
1145957677 17:28865745-28865767 GCTTCAAACCAGGAGCTCCATGG + Intergenic
1149448255 17:56730479-56730501 AATTTACAGCAACAGCTGCAAGG - Intergenic
1150999560 17:70358804-70358826 AGTATAAAGGTGGAGCTGCAGGG - Intergenic
1151472852 17:74328515-74328537 GCTCTGCAGCAGGAGCTGCAGGG + Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1156889649 18:42175985-42176007 ACTTGAAAGCATGAGGTGGAAGG - Intergenic
1158138237 18:54228909-54228931 ACCTTAAAGCAGGAGCTTAAAGG - Intergenic
1159320372 18:66839794-66839816 AATTTAAAGCATGATCTTCAAGG + Intergenic
1159321024 18:66848872-66848894 ACTTTGAAGCAAGAACTACAAGG + Intergenic
1159481191 18:68993038-68993060 GCTTTTGAGCAGCAGCTGCAGGG - Intronic
1160494137 18:79360328-79360350 TTTTTAAAGCAGTAGCTGTATGG + Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164412875 19:28020456-28020478 GGTTTAAAGCAGCAGCTGAAAGG - Intergenic
1165954439 19:39493330-39493352 ACTTGAACCCAGGAGGTGCAGGG - Intronic
1165961989 19:39542561-39542583 ACCTTACAGCAGAAGCTGAAAGG + Intergenic
1167467946 19:49659920-49659942 AGGTTACAGCAGGGGCTGCAGGG - Intronic
927572970 2:24175681-24175703 GCTTTAAAGCAGGCGTTGAAGGG + Exonic
930816118 2:55599742-55599764 TATTTAAAGCAGCAGCTGTAAGG - Intronic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
934950408 2:98571754-98571776 TCATTAAAGCAGGGGCTGCAGGG + Intronic
936089859 2:109494562-109494584 ACTTTGGAGGAGGAGCTGCTGGG + Intronic
936773039 2:115938049-115938071 ACCTTAATGCAGGAACTTCAGGG + Intergenic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
937315969 2:120932327-120932349 AGTGGAAAGCAGGAGGTGCAAGG - Intronic
939076601 2:137609903-137609925 ACTTTGAAGATGGAGCTGAAAGG + Intronic
940011877 2:149062963-149062985 TCGGTAAAGAAGGAGCTGCAAGG + Intronic
941993161 2:171576525-171576547 ACCTTAAGGCAGGAGCTGAAGGG + Intergenic
942792031 2:179771507-179771529 ATTTTAAGGCAGGAGCTAAAAGG - Intronic
944645675 2:201779005-201779027 GGTTTAAAGCAGTAGCTGCTGGG - Intronic
944906042 2:204263217-204263239 TCTTGAAAGCACGAGCTGAAAGG + Intergenic
945557683 2:211299721-211299743 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
946116861 2:217470567-217470589 ACTTTAACCCAGGAGGTGAAGGG - Intronic
947796646 2:232897252-232897274 GCATGAAAGCAGGAGCTCCAGGG + Intronic
1169432559 20:5551657-5551679 ACTTGAACCCAGGAGCTGGAGGG + Intronic
1169909089 20:10632712-10632734 ATTTCAAACCAGGAGCTGGAAGG + Intronic
1169999449 20:11598146-11598168 ACCTTAAAGCAGGAAGTGAAAGG - Intergenic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1174297596 20:49560231-49560253 ACTTTAAAAGGGGAGCTGGAGGG + Intronic
1175056327 20:56201938-56201960 ACCTTAAAGCGGGAACTTCAGGG - Intergenic
1175057473 20:56211333-56211355 ACCTTAAAGCAGGAGCCTAAAGG - Intergenic
1175481995 20:59318350-59318372 AATTAAAAGCTGGACCTGCAAGG + Intronic
1181945363 22:26512654-26512676 AGTACAAAGCAGGAGCGGCAGGG - Intergenic
1182483887 22:30627738-30627760 ATTTTAGTGGAGGAGCTGCAAGG - Intergenic
949373075 3:3356026-3356048 ACTGGAAAGCAGGAGTTGCTGGG + Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
950748120 3:15107101-15107123 ACCTTAAAGCGGGAGCTTAAGGG + Intergenic
953424041 3:42778250-42778272 ACTTTAAAGTTGGAACTACATGG - Intronic
953597694 3:44333929-44333951 AGCTTAAAGCAGGAGCTTAAGGG + Intergenic
955942658 3:64161080-64161102 ACTTTTAAGTAGGAGCGTCAGGG - Intronic
956884485 3:73545371-73545393 ACTTTACAGCAGTAGCTACCAGG - Intronic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
960009651 3:112819631-112819653 ACATTAAAGAAGGGGCTGGAGGG + Intronic
962743017 3:138377057-138377079 CATTTATAGCAGGAGCAGCAGGG + Intronic
963456033 3:145549355-145549377 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
964308271 3:155363501-155363523 ACCTTAAAGCGGAAGCTGAAGGG - Intergenic
965485893 3:169277953-169277975 ACTTTGAACCAGGAACTTCAGGG - Intronic
965966259 3:174494143-174494165 ACTTTAAGGCAGGAGGTTTAAGG + Intronic
967216125 3:187212069-187212091 ACTTTAAAGGTGGAGCTGAGAGG + Intergenic
967313905 3:188132569-188132591 AGTTAAGAGCAGTAGCTGCAAGG + Intergenic
968328978 3:197847760-197847782 ACTTCAAAGCAAAAGTTGCATGG + Intronic
968457694 4:707313-707335 ACTTTAAGGCAGGACCTTCCTGG - Intronic
970315668 4:14826400-14826422 ACTTTAAAGAAGGAGAGGCCAGG - Intergenic
971547383 4:27903484-27903506 ACTGAAAAGAAGGGGCTGCAGGG + Intergenic
974277987 4:59751451-59751473 ACCTTAAAGCGGGAGCTTAAAGG - Intergenic
975379289 4:73679674-73679696 ATTTTAAGGCAGGTTCTGCAAGG + Intergenic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
977451705 4:97207130-97207152 GCTTTGAATCAGGAGCTGCCTGG + Intronic
978396107 4:108281718-108281740 ATTTAAAAGCAGGAACTCCAAGG - Intergenic
979283919 4:118899297-118899319 ACTTTAAAGCATGAGATAAAAGG + Intronic
980703805 4:136465329-136465351 ACTTGAAAGCAACAGCTTCATGG + Intergenic
980902554 4:138918804-138918826 ACTTTAAAGCATGCCCTTCATGG - Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
981526477 4:145711154-145711176 ACCTTAAAGCAGAAGCTTTAAGG - Intronic
982057522 4:151567604-151567626 ATTTTAAAGCAGTATCTCCAAGG + Intronic
982453980 4:155585960-155585982 AATTTGAAGCATGACCTGCATGG - Intergenic
984829225 4:183955738-183955760 ACTTTAAAGAAGCGGATGCAAGG - Intronic
985693461 5:1326357-1326379 TCTGTAGAGGAGGAGCTGCATGG - Intronic
985693652 5:1327549-1327571 CCTGTAGAGCAGGAGCTGGATGG - Intronic
987573847 5:19702022-19702044 TCCTTAAAGCAGGAGCTTAAGGG - Intronic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
991473346 5:66993571-66993593 TCTTTCAAGCATGAGCTGTAAGG - Intronic
992366226 5:76092887-76092909 ACTCCACAGCTGGAGCTGCAAGG - Intronic
992910240 5:81389313-81389335 ACTTTGAACCAAGAGCTTCAAGG - Intronic
993679811 5:90862322-90862344 ACTTTAAAGCAAGCCTTGCAAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998209712 5:140185721-140185743 ACTTTAACACAGGAGCCCCAGGG - Intronic
999381898 5:151127176-151127198 ACTTTGCAGGAGGAGATGCAGGG - Intronic
1001587903 5:172845587-172845609 ATTTTAAATCATGAGTTGCAGGG - Intronic
1004417559 6:15438586-15438608 TCTTTAAAGCGGGGGCTGCCAGG - Intronic
1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG + Intronic
1007923766 6:45634510-45634532 GCTTTAAAGCAGGATCTTCCTGG + Intronic
1010235389 6:73571088-73571110 GCTTAAAAGCAGCAGCAGCACGG - Intergenic
1011536894 6:88385520-88385542 CTTTTAAAGCAGAAGCTACAAGG + Intergenic
1015274465 6:131369617-131369639 ACGCTAAACCAGGACCTGCATGG - Intergenic
1015406260 6:132840355-132840377 ATTTTAAAACTGGAGTTGCATGG + Intergenic
1016042337 6:139444229-139444251 TCTTTAAAGGAAGAGCTGCCAGG - Intergenic
1016354999 6:143209117-143209139 TCTTTATTGCAGGAACTGCAGGG - Intronic
1017008695 6:150047162-150047184 ACTTGAATGCAGGAGCTGGCAGG - Intergenic
1017553467 6:155537247-155537269 CTTTTAAAGCAGTAGCTCCACGG + Intergenic
1018619475 6:165715991-165716013 ACTTTAGTGCAGGAGCCGGAGGG - Intronic
1019648747 7:2144874-2144896 ACCTTGGAGCAGGAGCTTCATGG - Intronic
1020739435 7:11994999-11995021 TATTTAAAGGAGGATCTGCAGGG + Intergenic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1023216455 7:37868262-37868284 ACCTTAAAGCTGGAGCTTAAGGG + Intronic
1024212933 7:47222134-47222156 ACTTTAAAGCATGAATTTCATGG - Intergenic
1027449626 7:78316140-78316162 CATTTAAAGTAGTAGCTGCAGGG - Intronic
1027517162 7:79156595-79156617 AATTTGAAGCAGGAGCTTCCAGG - Intronic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1031875152 7:127131076-127131098 ACCTTAGTGCAGGAGTTGCATGG + Intronic
1034288496 7:149907750-149907772 ACATTAAAGCAAAAGGTGCAAGG + Intergenic
1034662576 7:152785117-152785139 ACATTAAAGCAAAAGGTGCAAGG - Intronic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1035889751 8:3330522-3330544 ACTTCTAAGCAGGAGCTAAATGG + Intronic
1039350174 8:36755609-36755631 ACTTTACAGAAGTAGCTACACGG - Intergenic
1039354585 8:36801003-36801025 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1040674544 8:49733303-49733325 ACTTTGAAGCAAGAGCAGCTGGG + Intergenic
1041533928 8:58904634-58904656 ACTCTTAAGCAGTAGCAGCAGGG + Intronic
1042280439 8:67050314-67050336 ACTTTAAAGCAGTAGATACTAGG - Intronic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1042869169 8:73381838-73381860 AGTCTAAAGCAAGAGCTGGAAGG + Intergenic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1044874212 8:96648342-96648364 ATTTTAAAGCTCTAGCTGCAGGG - Intronic
1046012914 8:108572117-108572139 ACTAAAAAGCAGTAGCTGAATGG + Intergenic
1046248437 8:111597390-111597412 ACTTTAAAAGAGAAGTTGCATGG + Intergenic
1046732138 8:117737216-117737238 ACTATCAAGCAGGTGCAGCATGG + Intergenic
1049427823 8:142545140-142545162 AGGGCAAAGCAGGAGCTGCAGGG - Intergenic
1050115669 9:2260868-2260890 AGTTTCAAGCAGGAGCTGACTGG + Intergenic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1054794425 9:69286535-69286557 ATTTTAAAGCAGTTGCTCCAAGG + Intergenic
1055287689 9:74746778-74746800 GCTTTAAGGCAGGAGCAGTAGGG + Intronic
1056514982 9:87341706-87341728 ACTGGGAAGCAGGAGCTGAAGGG - Intergenic
1057567353 9:96177384-96177406 ACTTTAAATCAGGAGTCACAAGG - Intergenic
1059585371 9:115600341-115600363 AATTTAAAGCAAAAGCTGCTAGG + Intergenic
1060354616 9:122893532-122893554 ACTTAACAGCAGGAGCTGTGTGG + Intronic
1061064465 9:128268718-128268740 AGCTCAAAGCAGGGGCTGCACGG + Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1185946666 X:4384562-4384584 ACCTTAAAGGGGGAGCTGAAGGG + Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1187093860 X:16126043-16126065 ACTGTAAAGATGCAGCTGCAGGG + Intronic
1189692880 X:43635324-43635346 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1189693462 X:43639857-43639879 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1192570240 X:72197587-72197609 TCTTTTGAGCTGGAGCTGCAAGG + Exonic
1193478593 X:81997855-81997877 ACTTAAAAACAGGAGCTAAATGG + Intergenic
1193500447 X:82267455-82267477 AACTTAAAGCAGGAGCTTAAGGG + Intergenic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1195047842 X:101069909-101069931 CCTTTAAAGCATGAGCCCCAGGG - Intergenic
1195138737 X:101937195-101937217 CTTTTAAAGCAAGACCTGCATGG - Intergenic
1196037168 X:111158144-111158166 ATTTTAAAGCAGGTCTTGCAAGG + Intronic
1199922968 X:152429154-152429176 AATTTAAAGAAGGAAATGCAGGG + Intronic
1200158345 X:153990384-153990406 AGTTGAAAGCAGGAGCTTGAAGG + Intergenic
1200728721 Y:6706922-6706944 AATTGAAAGCAGGAGATGCCAGG - Intergenic
1202591109 Y:26484171-26484193 ATTTTTAAGCTGGAGCTGGATGG + Intergenic