ID: 1186391783

View in Genome Browser
Species Human (GRCh38)
Location X:9167826-9167848
Sequence CTGGGAAAAGGCAGAATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186391781_1186391783 -7 Left 1186391781 X:9167810-9167832 CCATGTATATGACGTTCTGGGAA No data
Right 1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG No data
1186391776_1186391783 20 Left 1186391776 X:9167783-9167805 CCTCAAAAACCTCCACAGTGCAT No data
Right 1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG No data
1186391777_1186391783 11 Left 1186391777 X:9167792-9167814 CCTCCACAGTGCATGATTCCATG No data
Right 1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG No data
1186391775_1186391783 24 Left 1186391775 X:9167779-9167801 CCAACCTCAAAAACCTCCACAGT No data
Right 1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG No data
1186391778_1186391783 8 Left 1186391778 X:9167795-9167817 CCACAGTGCATGATTCCATGTAT No data
Right 1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186391783 Original CRISPR CTGGGAAAAGGCAGAATTGA AGG Intergenic
No off target data available for this crispr