ID: 1186400435

View in Genome Browser
Species Human (GRCh38)
Location X:9253712-9253734
Sequence CTACATAAAAAAATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186400433_1186400435 4 Left 1186400433 X:9253685-9253707 CCTAGTCAACATGGTGAGACATT No data
Right 1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG No data
1186400432_1186400435 8 Left 1186400432 X:9253681-9253703 CCAGCCTAGTCAACATGGTGAGA No data
Right 1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG No data
1186400430_1186400435 23 Left 1186400430 X:9253666-9253688 CCAAGGAGTTCAAGACCAGCCTA 0: 861
1: 11078
2: 21140
3: 31109
4: 27149
Right 1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG No data
1186400428_1186400435 25 Left 1186400428 X:9253664-9253686 CCCCAAGGAGTTCAAGACCAGCC No data
Right 1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG No data
1186400429_1186400435 24 Left 1186400429 X:9253665-9253687 CCCAAGGAGTTCAAGACCAGCCT 0: 21
1: 344
2: 625
3: 964
4: 1008
Right 1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186400435 Original CRISPR CTACATAAAAAAATTTAGCT GGG Intergenic
No off target data available for this crispr