ID: 1186400549

View in Genome Browser
Species Human (GRCh38)
Location X:9254942-9254964
Sequence CTGGGAATAAGCAGTTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186400549_1186400555 21 Left 1186400549 X:9254942-9254964 CCTTGGAAACTGCTTATTCCCAG No data
Right 1186400555 X:9254986-9255008 AATGTTCCAGCAATATCATATGG No data
1186400549_1186400552 -10 Left 1186400549 X:9254942-9254964 CCTTGGAAACTGCTTATTCCCAG No data
Right 1186400552 X:9254955-9254977 TTATTCCCAGACTGAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186400549 Original CRISPR CTGGGAATAAGCAGTTTCCA AGG (reversed) Intergenic
No off target data available for this crispr