ID: 1186405843

View in Genome Browser
Species Human (GRCh38)
Location X:9301589-9301611
Sequence TCTCCTCGAACGTCTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186405843_1186405844 16 Left 1186405843 X:9301589-9301611 CCTCAGGAAGACGTTCGAGGAGA No data
Right 1186405844 X:9301628-9301650 AGCAAAATAGAAACTAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186405843 Original CRISPR TCTCCTCGAACGTCTTCCTG AGG (reversed) Intergenic
No off target data available for this crispr