ID: 1186408879

View in Genome Browser
Species Human (GRCh38)
Location X:9328439-9328461
Sequence ATGGACTACCTCAATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186408875_1186408879 -6 Left 1186408875 X:9328422-9328444 CCAATTTGTAACCACCAATGGAC No data
Right 1186408879 X:9328439-9328461 ATGGACTACCTCAATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186408879 Original CRISPR ATGGACTACCTCAATAAGGA AGG Intergenic
No off target data available for this crispr