ID: 1186410361

View in Genome Browser
Species Human (GRCh38)
Location X:9340948-9340970
Sequence AGGGGACCAAAAGGCCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186410361_1186410370 16 Left 1186410361 X:9340948-9340970 CCGGGAAGGCCTTTTGGTCCCCT No data
Right 1186410370 X:9340987-9341009 GCCCACACAGTTAAAATGCAGGG No data
1186410361_1186410369 15 Left 1186410361 X:9340948-9340970 CCGGGAAGGCCTTTTGGTCCCCT No data
Right 1186410369 X:9340986-9341008 AGCCCACACAGTTAAAATGCAGG No data
1186410361_1186410375 19 Left 1186410361 X:9340948-9340970 CCGGGAAGGCCTTTTGGTCCCCT No data
Right 1186410375 X:9340990-9341012 CACACAGTTAAAATGCAGGGGGG No data
1186410361_1186410372 17 Left 1186410361 X:9340948-9340970 CCGGGAAGGCCTTTTGGTCCCCT No data
Right 1186410372 X:9340988-9341010 CCCACACAGTTAAAATGCAGGGG No data
1186410361_1186410374 18 Left 1186410361 X:9340948-9340970 CCGGGAAGGCCTTTTGGTCCCCT No data
Right 1186410374 X:9340989-9341011 CCACACAGTTAAAATGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186410361 Original CRISPR AGGGGACCAAAAGGCCTTCC CGG (reversed) Intergenic
No off target data available for this crispr