ID: 1186412889

View in Genome Browser
Species Human (GRCh38)
Location X:9359363-9359385
Sequence CCTCCCTCCTGCAGTGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186412889_1186412891 14 Left 1186412889 X:9359363-9359385 CCTAACTCACTGCAGGAGGGAGG No data
Right 1186412891 X:9359400-9359422 TTTTTTAGAGTGTTGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186412889 Original CRISPR CCTCCCTCCTGCAGTGAGTT AGG (reversed) Intergenic
No off target data available for this crispr