ID: 1186412891

View in Genome Browser
Species Human (GRCh38)
Location X:9359400-9359422
Sequence TTTTTTAGAGTGTTGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186412884_1186412891 23 Left 1186412884 X:9359354-9359376 CCCAGTACGCCTAACTCACTGCA No data
Right 1186412891 X:9359400-9359422 TTTTTTAGAGTGTTGCAACAAGG No data
1186412889_1186412891 14 Left 1186412889 X:9359363-9359385 CCTAACTCACTGCAGGAGGGAGG No data
Right 1186412891 X:9359400-9359422 TTTTTTAGAGTGTTGCAACAAGG No data
1186412885_1186412891 22 Left 1186412885 X:9359355-9359377 CCAGTACGCCTAACTCACTGCAG No data
Right 1186412891 X:9359400-9359422 TTTTTTAGAGTGTTGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186412891 Original CRISPR TTTTTTAGAGTGTTGCAACA AGG Intergenic
No off target data available for this crispr