ID: 1186416457

View in Genome Browser
Species Human (GRCh38)
Location X:9386998-9387020
Sequence ATCCCAGGAGACACCCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186416457_1186416460 19 Left 1186416457 X:9386998-9387020 CCCTTATGGGTGTCTCCTGGGAT No data
Right 1186416460 X:9387040-9387062 TTGCACTCAAATCCTGTCTCTGG No data
1186416457_1186416461 30 Left 1186416457 X:9386998-9387020 CCCTTATGGGTGTCTCCTGGGAT No data
Right 1186416461 X:9387051-9387073 TCCTGTCTCTGGTCTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186416457 Original CRISPR ATCCCAGGAGACACCCATAA GGG (reversed) Intergenic
No off target data available for this crispr