ID: 1186419908

View in Genome Browser
Species Human (GRCh38)
Location X:9417344-9417366
Sequence GGGTGAAGAAAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186419908_1186419910 -6 Left 1186419908 X:9417344-9417366 CCTTGTTCCATCTTTCTTCACCC No data
Right 1186419910 X:9417361-9417383 TCACCCCCATCCTCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186419908 Original CRISPR GGGTGAAGAAAGATGGAACA AGG (reversed) Intergenic
No off target data available for this crispr