ID: 1186421877

View in Genome Browser
Species Human (GRCh38)
Location X:9433078-9433100
Sequence GGATGGATCTTCTTTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186421877_1186421884 3 Left 1186421877 X:9433078-9433100 CCCATCTGAAAGAAGATCCATCC No data
Right 1186421884 X:9433104-9433126 GGCTGTGTCCCCATCCCTGGAGG No data
1186421877_1186421883 0 Left 1186421877 X:9433078-9433100 CCCATCTGAAAGAAGATCCATCC No data
Right 1186421883 X:9433101-9433123 TTGGGCTGTGTCCCCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186421877 Original CRISPR GGATGGATCTTCTTTCAGAT GGG (reversed) Intergenic
No off target data available for this crispr