ID: 1186424933

View in Genome Browser
Species Human (GRCh38)
Location X:9456460-9456482
Sequence GTGCTCACCCGCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186424929_1186424933 -5 Left 1186424929 X:9456442-9456464 CCCTCAGTGGCTCAGAGGGTGCT No data
Right 1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG No data
1186424923_1186424933 24 Left 1186424923 X:9456413-9456435 CCATGCTCTGCCTTTGTGTTCTG No data
Right 1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG No data
1186424922_1186424933 28 Left 1186424922 X:9456409-9456431 CCAGCCATGCTCTGCCTTTGTGT No data
Right 1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG No data
1186424930_1186424933 -6 Left 1186424930 X:9456443-9456465 CCTCAGTGGCTCAGAGGGTGCTC No data
Right 1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG No data
1186424925_1186424933 14 Left 1186424925 X:9456423-9456445 CCTTTGTGTTCTGTTCAGGCCCT No data
Right 1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186424933 Original CRISPR GTGCTCACCCGCACTGAGGA GGG Intergenic
No off target data available for this crispr