ID: 1186425878

View in Genome Browser
Species Human (GRCh38)
Location X:9464606-9464628
Sequence CCCTGCCCCCTAGAAACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186425873_1186425878 24 Left 1186425873 X:9464559-9464581 CCTTTTTGGGGTGGGGGAGGGTA 0: 1
1: 0
2: 1
3: 45
4: 336
Right 1186425878 X:9464606-9464628 CCCTGCCCCCTAGAAACTGAGGG 0: 1
1: 1
2: 1
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186425878 Original CRISPR CCCTGCCCCCTAGAAACTGA GGG Intronic
901132999 1:6974299-6974321 CCTAGACCCCAAGAAACTGAAGG - Intronic
901685327 1:10940543-10940565 CCCTGCCCTGTAGTAACAGAGGG + Intergenic
902412303 1:16218503-16218525 CCCTGCCTCCAGGAAACGGAAGG - Intergenic
903663254 1:24991467-24991489 CCCTGCCCTCTAGGAGCTCACGG - Intergenic
903793340 1:25909519-25909541 CCCTGCCCTCTAGGACCTAATGG - Intergenic
906124737 1:43420823-43420845 CCCTGGCCCCTGGAGCCTGAGGG + Exonic
907505936 1:54918304-54918326 CCCTGCCTCCTAGGTACTAATGG - Intergenic
907994751 1:59618797-59618819 CCATGCCCCTGAGAGACTGAGGG - Intronic
908439803 1:64142316-64142338 CCCTCCCCTCCAGAAACTGCTGG + Intronic
910590633 1:88925399-88925421 CCCTGCCTCCTAGGTACTAATGG + Intergenic
912560501 1:110548185-110548207 TCCTGGCCCTGAGAAACTGAGGG - Intergenic
913030064 1:114892721-114892743 CCCTGCCCCCTACCAACAGCAGG - Intronic
915561757 1:156692011-156692033 CCCTGCACCCCAGAAACTGTGGG - Intergenic
917389427 1:174518279-174518301 CAATCCCCCCTAGATACTGAGGG - Intronic
918323929 1:183391823-183391845 TCGTGCCCCCTAAACACTGATGG + Intronic
920077794 1:203349832-203349854 CTCTGCAACCTAGGAACTGATGG - Intronic
920848790 1:209614703-209614725 CCCTCTGCCCTAGAACCTGATGG - Intergenic
920933760 1:210412266-210412288 CCCTGCCCCCTGAAAATTAATGG + Intronic
922752480 1:228077081-228077103 CCCAGCCCCCTAAAACCTGGAGG + Intergenic
923294976 1:232585437-232585459 CACTGCCCCTTAGACACTGTAGG - Intergenic
923467167 1:234259473-234259495 CCCTGCCCCAGAGGAACTGGAGG - Intronic
924773378 1:247096420-247096442 CCCTGCACCCTGAAAACTGAAGG + Intergenic
1065879439 10:30026658-30026680 CCCTGTCCCCTACAAAGAGAGGG + Exonic
1066211032 10:33238510-33238532 TCCTGCCCTCTAGACAGTGAGGG + Intronic
1066596123 10:37051922-37051944 TTCTGCCCCCTGGAAAGTGATGG - Intergenic
1068617882 10:59139855-59139877 CCCTGACCCCAAGACTCTGAAGG - Intergenic
1070289795 10:75106691-75106713 CCCTGCCCTCTTGGAACTGGTGG - Intronic
1071460276 10:85887361-85887383 AGCTGCCCCCTAAAAACTTATGG + Intronic
1072472239 10:95723553-95723575 CCCTGCCTCCTAGGTACTAATGG - Intronic
1073132681 10:101200374-101200396 CCCTGCACGCTTGACACTGAAGG + Intergenic
1074554613 10:114476825-114476847 TCCTGGCCACTTGAAACTGAAGG - Intronic
1075058182 10:119235748-119235770 CCCTGTTCCCATGAAACTGATGG - Intronic
1076744827 10:132507594-132507616 CCAGGACCCCTTGAAACTGAAGG + Intergenic
1078995921 11:16699374-16699396 CGCTGCCACCAAGAAACTTATGG + Intronic
1079089572 11:17471175-17471197 CCCTGCCCTTGAGAAGCTGATGG + Intronic
1079507519 11:21169951-21169973 CCCTGTCCCCTACAAAGAGAGGG - Intronic
1079584414 11:22108082-22108104 TCCTGCTCATTAGAAACTGAGGG - Intergenic
1079601601 11:22317100-22317122 CCCTGCCTCCTAGGTACTAATGG - Intergenic
1079908309 11:26277063-26277085 CCCTGCCCCCAAGTAAATGAAGG - Intergenic
1081622950 11:44629855-44629877 CCCTGCCCTCGAGGAACTTAGGG - Intergenic
1081851629 11:46278406-46278428 CCCTTCCCCCTAGAAGGTGGAGG - Intronic
1081993339 11:47349208-47349230 CCCTGCCCACCAGAACCTTAAGG - Intronic
1083201695 11:61124696-61124718 CCCTGCCCTCCAGGAGCTGAGGG - Intronic
1083742836 11:64720283-64720305 CCCTGCCCCTTCCACACTGATGG - Intronic
1084721893 11:70911687-70911709 CCCTGGCCCATAGAAGCTGCAGG - Intronic
1084868651 11:72080735-72080757 CCCCGCCCCTGACAAACTGAAGG + Exonic
1085119712 11:73959244-73959266 CCCTGCCCCCAGCAAACTCAAGG + Intronic
1085603213 11:77874156-77874178 CCTTGCTCCCTAGAAGCAGACGG + Intronic
1088349643 11:108871334-108871356 CCCTTTCCCATAGAAGCTGAAGG - Intronic
1088541777 11:110920777-110920799 CCCTGGCCCCTAGACTCTCAGGG - Intergenic
1090444162 11:126749020-126749042 CCCTGCCACCTGGAGACTGCAGG - Intronic
1090489965 11:127151318-127151340 CCCTGCCGTCTAGAAGCTTAAGG - Intergenic
1092131920 12:6118842-6118864 CCCTGCCCCTGGGAAGCTGAAGG - Intronic
1093120495 12:15265837-15265859 CTCTTCCCCCTAGTAACTTAAGG + Intronic
1094306350 12:29023970-29023992 CCCTGTCCCCTAGAAAATCCAGG + Intergenic
1095174577 12:39076804-39076826 CGCTGAACCCTAGAAATTGATGG - Intergenic
1095265408 12:40150927-40150949 CCCCACCCCCTAAAAAATGAAGG + Intergenic
1095400528 12:41809571-41809593 CCTTGCCCCCTACACCCTGATGG - Intergenic
1096787753 12:54027344-54027366 CCCTGCCCCCTCCAGACTCAGGG - Intronic
1096933419 12:55241847-55241869 GCCTGCCCCCTAGAGTCTCAGGG - Intergenic
1097377617 12:58858541-58858563 CCCTGCCTCCTAGGCACTAATGG - Intergenic
1102960998 12:117093172-117093194 CCCTGCCCTCCAGAAGCTCAGGG - Intronic
1103090581 12:118095396-118095418 CCCTGCCACATGGAAGCTGAGGG - Intronic
1103855166 12:123963083-123963105 CCCTGCCCACTAGATGCTGGTGG - Intronic
1104208592 12:126664861-126664883 CCCTGCCCCCAGGACACTTAAGG - Intergenic
1105290190 13:19048525-19048547 CGCTGCCCCACAGAACCTGAGGG + Intergenic
1107588555 13:41879834-41879856 TCCTGGCCTCCAGAAACTGAAGG + Intronic
1110421448 13:75313968-75313990 CCCTGTCCCCCAAAAATTGAGGG - Intronic
1111021593 13:82458555-82458577 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1114383992 14:22237580-22237602 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1117464256 14:55976292-55976314 CCCTGCCCCATCCAAACTCAAGG - Intergenic
1118206033 14:63724485-63724507 GCCTTTCCCCTAGAAACTGGGGG - Intronic
1120438282 14:84505036-84505058 TCTTGCCCCCTAGAAAGAGAAGG + Intergenic
1121835123 14:97085320-97085342 CCCTGCCACTTACAAACTGTAGG + Intergenic
1122122293 14:99561016-99561038 CCCTGCCCTGTGGAGACTGAGGG - Intronic
1124017921 15:25893508-25893530 CCCTGCCCTCTAGTAACTTAGGG - Intergenic
1126022361 15:44414925-44414947 TCCTGCCCCCTAAAAACAAAAGG + Exonic
1127900865 15:63339880-63339902 CCCTGCCCCCAAGAAGCTCAAGG - Intronic
1129728324 15:77915416-77915438 CCCAGCCCCCCAGGAACTGGGGG - Intergenic
1129890041 15:79065782-79065804 CCCTGCCACCTGGACACCGAGGG - Intronic
1130913604 15:88287988-88288010 CCCTTCCCCCTGGAAACTGATGG - Intergenic
1131923145 15:97352463-97352485 CCCTGCCCCCTAAAATCTTATGG - Intergenic
1132186222 15:99804173-99804195 CCCTCCCCCCTCTAAAATGAAGG - Intergenic
1132210853 15:100021103-100021125 CCCTGTTCCCTAGTATCTGAAGG - Intronic
1132429451 15:101748533-101748555 CCCTCCCCCCTCTAAAATGAAGG + Intergenic
1133463209 16:6005430-6005452 CCCTGCCCCCAAGGAGCTCATGG + Intergenic
1134336661 16:13305965-13305987 CCCTGCCCTCCAGAAGCTCATGG + Intergenic
1134410493 16:13999910-13999932 TACTTCCTCCTAGAAACTGAAGG - Intergenic
1134610241 16:15602247-15602269 CCCTGCCCCGTGGAAAGTGAAGG + Intronic
1135423576 16:22321111-22321133 CCCTAATCCCTTGAAACTGATGG - Intronic
1135541586 16:23334055-23334077 CCCTGCCCCATAGAATGAGAGGG + Intronic
1135916219 16:26607839-26607861 CCCTGTACCCAGGAAACTGAGGG - Intergenic
1136990652 16:35149404-35149426 CCCTGCCCTATAGACAATGAAGG - Intergenic
1138442037 16:57040965-57040987 CCCTGACCCCCAGCAGCTGAGGG + Intronic
1141585551 16:85031228-85031250 CCCTGGCCCCTACAAAGTGCTGG - Intronic
1141956517 16:87375627-87375649 CCCAGCACCCCAGAAAGTGAAGG + Intronic
1142505308 17:359598-359620 CCCTGCCCCCCACAAAGTGCTGG + Intronic
1143388655 17:6547188-6547210 CCCTTACCCCTAGAAACAGGCGG - Intronic
1144783936 17:17821601-17821623 CTCTTCCCCCTGTAAACTGAGGG - Intronic
1146234074 17:31141668-31141690 TCCTGACCCATAGAAACTGTGGG - Intronic
1146747702 17:35346548-35346570 CCCTGCCCCTTAGACAGAGAAGG - Intergenic
1157194166 18:45606932-45606954 TCCTGCCCTCCAGGAACTGAGGG - Intronic
1157480727 18:48051910-48051932 CACTGCCCCCTAGAAAATAAAGG - Intronic
1161899695 19:7109348-7109370 CCCTGCCCCATAGATGCTCATGG + Intergenic
1162059766 19:8087376-8087398 CCCAGCCTCCAAGAAGCTGAGGG + Intronic
1163526225 19:17823175-17823197 CCCTGCCCCCCAGAAAAGGCAGG - Intergenic
1164173307 19:22746371-22746393 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1164837090 19:31363422-31363444 ACGTGGCCCCTGGAAACTGAAGG - Intergenic
1165834259 19:38744612-38744634 CACTGCACTCCAGAAACTGATGG - Intronic
1166268003 19:41696835-41696857 CCATGCCCCATAGAACCAGATGG + Intronic
1166942013 19:46373055-46373077 CCCTACTTTCTAGAAACTGAGGG + Intronic
1168586768 19:57600165-57600187 CCCTCCCCACCCGAAACTGAGGG + Intronic
925215588 2:2092905-2092927 CCCTGCCCTTTAGCAGCTGAAGG + Intronic
926329247 2:11811114-11811136 CCCTGCCCCACAGAAGCAGAGGG - Intronic
926703067 2:15817022-15817044 TCCTGCCTCCTAGAAACACATGG - Intergenic
929948390 2:46387926-46387948 CCCAGCCCCCTAACAACTGCAGG + Intergenic
930631286 2:53757569-53757591 CCCTGCCTCCTAGGTACTAATGG + Intronic
931168454 2:59776681-59776703 CCCTTTCCCCTAGAAACTTTTGG + Intergenic
932917327 2:75872932-75872954 CCCTGCCTCCTAGGTACTAATGG + Intergenic
934672286 2:96222323-96222345 CCCTGCCTCCTAGGTACTAATGG - Intergenic
936232678 2:110717505-110717527 CCCCACCCCACAGAAACTGAAGG - Intergenic
936387591 2:112043997-112044019 CCCTGCCTCCTAGGTACTAATGG - Intergenic
938142621 2:128809093-128809115 CCCTGCAGCCTAGCAACAGAAGG - Intergenic
938891638 2:135711624-135711646 CGCTGCCCCCTAGCAACAGAGGG + Intronic
940997342 2:160163942-160163964 CCCTCACCCCTATAAAGTGAAGG + Intronic
942580557 2:177412161-177412183 CCCTGCCTCCTAGATACTAATGG - Intronic
942888641 2:180960480-180960502 TTCTGCCCTCTAGAAACTTAAGG - Intergenic
946163886 2:217852167-217852189 CTTTGCCCCCTAGAAACAGGCGG - Intronic
947472517 2:230412175-230412197 CCCTGTCCCCTGGTAACTGACGG - Intergenic
948109760 2:235445184-235445206 CCCTGCCCCCCAGCAGCTTAAGG + Intergenic
948168807 2:235884206-235884228 CCATCCCCCATAGATACTGAGGG - Intronic
1171504514 20:25623119-25623141 CCCTTTCCCCTTGAAGCTGAAGG + Intronic
1175500013 20:59443034-59443056 CTCTGCCTCCTTGAAAGTGAGGG - Intergenic
1176110282 20:63407779-63407801 CCCTGCTCCCTGGAAGCTGGAGG + Intronic
1177079491 21:16620776-16620798 CCCTGACCCCTAGCAACTACTGG + Intergenic
1177263831 21:18759310-18759332 CCCTGCCTCCTAGGTACTGATGG - Intergenic
1178951716 21:36990694-36990716 CCCTGCCCACTAGAAACTGAGGG + Intergenic
1179259460 21:39745408-39745430 CCCTGCCTCCTAGGTACTAATGG - Exonic
1179535953 21:42052220-42052242 ACCTGCCCCCCAGTAACTTATGG - Intergenic
1179945205 21:44669500-44669522 CCTTGCCCCCTTGATGCTGAGGG - Intronic
1180082364 21:45492834-45492856 CACTGCCCCCAAGGAAATGATGG + Intronic
1180861906 22:19088204-19088226 CTCTGCCCCCTGGGAACTCATGG + Intronic
1180871935 22:19151079-19151101 CACTGCCCCCCAGAAGCTGTGGG + Intergenic
1181935572 22:26436099-26436121 CCCTGCCCCCAGGAAACAGTGGG + Intronic
1182162951 22:28141625-28141647 AGCTGTCTCCTAGAAACTGAAGG + Intronic
1182304698 22:29359748-29359770 CCCCGCCCCAAAGAGACTGAGGG + Intronic
1182326411 22:29516641-29516663 CCCTGCCCTTTACAACCTGAGGG + Intronic
949821289 3:8118461-8118483 TTCTGCCCCCAAGAAACTTATGG + Intergenic
950124582 3:10503569-10503591 CCTTGCCTCCTGGAAGCTGAGGG + Intronic
951201033 3:19875630-19875652 CCCTGCCTCCTAGGTACTAATGG - Intergenic
952359247 3:32613465-32613487 CCCTTCCATCTAGAAGCTGAAGG - Intergenic
952922551 3:38296048-38296070 CCCTGCCTCCTAGGTACTAATGG - Intronic
953633963 3:44646044-44646066 ACCAGCCCCCAAGAAACTGTGGG - Intronic
953801905 3:46031092-46031114 CCCTGCCCCTTAGAAGTTGGTGG + Intergenic
954263168 3:49454672-49454694 CACTGCCCTCTAGAGCCTGAGGG - Intergenic
954672278 3:52297498-52297520 CCCTGCCCCCTAGAAACCCCCGG - Intergenic
955590547 3:60530348-60530370 CCCTGGCCCCTTCAAAATGAAGG - Intronic
956033236 3:65062133-65062155 TCCTGCCCTCTAAAAAATGAAGG + Intergenic
958016596 3:87945364-87945386 CCCTGCCTCCTAGGTACTAATGG - Intergenic
958630219 3:96674180-96674202 CCCTGCCTCCTAGGTACTAATGG - Intergenic
960373061 3:116864520-116864542 CACTGCCACCTAGCATCTGAAGG - Intronic
960674819 3:120183682-120183704 CACTGCCCCCTAGACACTTCTGG - Intronic
963735041 3:149009625-149009647 CCATGAACCCCAGAAACTGATGG - Intronic
963915464 3:150855251-150855273 CCCTGCCTCCTAGGTACTAATGG + Intergenic
966343164 3:178947920-178947942 CACTGACCCCTAGAGACAGAGGG + Intergenic
966849318 3:184155209-184155231 CCCGGGTCCCTAGAAACGGAAGG - Intronic
967623260 3:191659785-191659807 CCCTGCCTCCTAGGTACTAATGG + Intergenic
968391477 4:196462-196484 CCCTGCCTCCTAGGCACTAATGG - Intergenic
969446030 4:7245138-7245160 CCCTTCCCCCTGGAAGCTGCAGG + Intronic
969619344 4:8271103-8271125 CCCTGCCACCTGCAAGCTGATGG - Intronic
973934602 4:55830417-55830439 CCCTGCCCTCTAAAAATTTATGG - Intergenic
974866939 4:67592689-67592711 CCCTGTCCCTTAAAAAATGAGGG - Intronic
976600788 4:86935617-86935639 CCCTCCCCCCGAGAAACTTCTGG - Intronic
978164902 4:105595603-105595625 CAGTGCCCCGTAGATACTGAGGG - Intronic
978272957 4:106913514-106913536 CTCTTCCCTCTAGAATCTGAAGG - Intergenic
978909175 4:114045378-114045400 CCCTGCCTCCTAGGTACTAATGG + Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
980443953 4:132883273-132883295 CCCTGCCTCCTAGGTACTAATGG + Intergenic
980926247 4:139141117-139141139 CCCAGGCCCCTTGAAAATGAGGG - Intronic
981652725 4:147077683-147077705 CTCTGCTCCCTAGAGATTGAGGG - Intergenic
982352651 4:154432891-154432913 CCCTTCCCTCTAGAAGCTGAAGG - Intronic
983667291 4:170196097-170196119 CCCTGCCTCCTAGGTACTAATGG - Intergenic
984496574 4:180505490-180505512 GCCTTCCACCTAGAAAATGATGG - Intergenic
985314214 4:188637484-188637506 CCCTGTCCCACAGAAACTGGGGG - Intergenic
986030821 5:3890981-3891003 CCCTGCACCCCAGGACCTGAAGG - Intergenic
987414652 5:17649918-17649940 CCCTGCCCACAAAAAACTCAAGG - Intergenic
988740396 5:34063798-34063820 CCCTGCCTCCTAGGTACTAATGG - Intronic
995465314 5:112444932-112444954 CCCTGCCTCCTAGGTACTAATGG + Intergenic
996519952 5:124415243-124415265 AATTGCCTCCTAGAAACTGAGGG + Intergenic
997695687 5:135858897-135858919 TCCTTCCCCCAAGCAACTGAGGG - Intronic
997833448 5:137172848-137172870 CCCTGCCTCCTGGAACCTAAAGG + Intronic
997880804 5:137587750-137587772 TCCTGTACCCTAGAAACTGTGGG + Intronic
1001256574 5:170187887-170187909 CCCTGCCCCCAGGAAGCTGATGG + Intergenic
1004236499 6:13879316-13879338 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1004870372 6:19898149-19898171 CCCTGCCCTCTAGGAGGTGATGG + Intergenic
1004870915 6:19903065-19903087 CTCTGGCCCCTAGAAACTAGAGG + Intergenic
1005323988 6:24681797-24681819 CCCTGCCTCCTAGGTACTAATGG - Intronic
1005868281 6:29954057-29954079 TCCTGACCACTAGAAACTGTGGG + Intergenic
1006652842 6:35565776-35565798 CTCTACCCCCTAAAAACTGCAGG - Intergenic
1006923401 6:37640749-37640771 CCCTGCCCCAAGGACACTGATGG - Intronic
1007297048 6:40832262-40832284 CCCTCCTCCCTTGAACCTGACGG + Intergenic
1007360777 6:41353653-41353675 ACCTGCCCCCTAGAGAAGGACGG + Intergenic
1008835705 6:55825236-55825258 ACCTGCTCCCTAGAAGCAGAAGG - Intronic
1008966589 6:57318818-57318840 CCCTGCCACCTAGAACATAATGG - Intronic
1009544468 6:65005962-65005984 CCCTGCCTCCTAGGTACTAATGG + Intronic
1011076534 6:83444738-83444760 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1011540233 6:88420482-88420504 CCCTGCCTCCTAGGTACTAATGG - Intergenic
1012821846 6:104094094-104094116 CCCTGCCCTTTAGAAGCTAATGG + Intergenic
1012893075 6:104919186-104919208 CCCTGCCCCCCTCAAAATGAGGG + Intergenic
1013021909 6:106229130-106229152 CCCTGCCTCCTAGGTACTAATGG + Intronic
1013543220 6:111131951-111131973 CCCTGCCTCCTAGGTACTAATGG + Intronic
1013671978 6:112414076-112414098 CCCTGGACCCTAGAAAGAGAAGG + Intergenic
1018668343 6:166160121-166160143 CCTTCCTCCCTAGAAAGTGAGGG + Intronic
1018760715 6:166892138-166892160 CCCTGCCTCCTAGGTACTAATGG + Intronic
1019175547 6:170157603-170157625 CCATGCCCCCCACAACCTGAGGG - Intergenic
1021197796 7:17691996-17692018 CCCTGCCCCCTACAAACCATCGG + Intergenic
1022275675 7:28853807-28853829 CCCTGCCCCCTAAAAAGTCAGGG - Intergenic
1024607410 7:51033935-51033957 CCCTGCCCTCTAGAAACAGCAGG + Intronic
1024676418 7:51641709-51641731 CCCTTCCCCATAGACACTGCAGG + Intergenic
1028103660 7:86851663-86851685 CCCTTCCCCCAGGAAACTGAAGG + Intronic
1028717016 7:93982539-93982561 CCTTGCCCTCAAGAGACTGAAGG + Intronic
1029404762 7:100367911-100367933 GCCTCCCCACTAGAAACAGATGG + Intronic
1030086144 7:105817577-105817599 CCCTACCCCCAAGAAACAGAAGG + Intronic
1030843845 7:114385283-114385305 CCCTGCCTCCTAGGTACTAATGG - Intronic
1031977317 7:128102377-128102399 CCCTGCCCCATACTTACTGAAGG - Intergenic
1032458153 7:132088822-132088844 CCCAGCCCCCAAGGAGCTGAGGG + Intergenic
1037960625 8:23095284-23095306 AACTGACCCCTAGAAACTAATGG + Intronic
1038535544 8:28350501-28350523 CCATGCCCCCTAGACGCAGAAGG - Intronic
1042055802 8:64763935-64763957 CCCTGCCTCCTAGGTACTAATGG + Intronic
1044256717 8:90071892-90071914 CCCTGCCCTCTTGAAATTAATGG - Intronic
1044881203 8:96724674-96724696 CACTGGCCCCAAGAAACTTATGG + Intronic
1046048643 8:108993789-108993811 ACGTGGCCCCTAGAAACAGAAGG + Intergenic
1048551088 8:135434030-135434052 CCCTGCCTCCTAAAACCTCAAGG + Intergenic
1050585244 9:7103992-7104014 CCCTGCCCTCAAGGAACTCACGG - Intergenic
1050799843 9:9596947-9596969 TTCTGCCCCAAAGAAACTGAAGG + Intronic
1052979171 9:34435153-34435175 CCCTGCCTCCTAGAAGCTACAGG + Intronic
1053081129 9:35177747-35177769 CCTTGCCCTCAAGAAATTGAGGG + Intronic
1054829307 9:69605989-69606011 CCCAGTCTCCTAGAACCTGAAGG + Intronic
1055610920 9:78023147-78023169 CCCTGCCCTCTGGAAAAGGAAGG + Intronic
1058873396 9:109221517-109221539 CCCTCCCACCTAGACAATGATGG - Intronic
1061092452 9:128434244-128434266 CCCTGCCCCCTTGTCCCTGAGGG - Intronic
1061578096 9:131520269-131520291 CGCTGCACCCTAGAAAGTGCTGG + Intronic
1062031133 9:134362489-134362511 TCCTGCCCCCTTGAAGCTCACGG - Intronic
1062438295 9:136556842-136556864 CCCCTCCCCCCAGAACCTGAAGG + Intergenic
1186254385 X:7703046-7703068 CCCTGCCTCCTAGGTACTAATGG - Intergenic
1186425878 X:9464606-9464628 CCCTGCCCCCTAGAAACTGAGGG + Intronic
1189319037 X:40076229-40076251 CCCTGTCCCCTAGTGACTGGTGG - Intronic
1190634594 X:52421024-52421046 CCCTGCCCATTAGAAACTCCAGG - Intergenic
1195584747 X:106552225-106552247 CCCTGCCTCCTAGGTACTAATGG + Intergenic
1198278990 X:135123835-135123857 CCCCTCCCCCTAGAAATTTAGGG - Intergenic
1198291968 X:135248685-135248707 CCCCTCCCCCTAGAAATTTAGGG + Intergenic
1198662112 X:138980998-138981020 CCCTGCCCTCTACAAGCTCATGG + Intronic
1199581764 X:149367603-149367625 TCCTGCCCCCTAGGAACTCATGG - Intergenic