ID: 1186425893

View in Genome Browser
Species Human (GRCh38)
Location X:9464647-9464669
Sequence CTTTCCACGACTGCCTCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186425893_1186425902 -1 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425902 X:9464669-9464691 GGCTGGGTTTGGGATGTGATGGG No data
1186425893_1186425910 29 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425910 X:9464699-9464721 CTGGGGTCCTCTCAGTCCCACGG No data
1186425893_1186425905 10 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425905 X:9464680-9464702 GGATGTGATGGGGGTAGCCCTGG No data
1186425893_1186425907 12 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425907 X:9464682-9464704 ATGTGATGGGGGTAGCCCTGGGG No data
1186425893_1186425904 1 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425904 X:9464671-9464693 CTGGGTTTGGGATGTGATGGGGG No data
1186425893_1186425901 -2 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425901 X:9464668-9464690 AGGCTGGGTTTGGGATGTGATGG No data
1186425893_1186425906 11 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425906 X:9464681-9464703 GATGTGATGGGGGTAGCCCTGGG No data
1186425893_1186425903 0 Left 1186425893 X:9464647-9464669 CCCCTCGAGGCAGTCGTGGAAAG No data
Right 1186425903 X:9464670-9464692 GCTGGGTTTGGGATGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186425893 Original CRISPR CTTTCCACGACTGCCTCGAG GGG (reversed) Intronic