ID: 1186425896

View in Genome Browser
Species Human (GRCh38)
Location X:9464649-9464671
Sequence GCCTTTCCACGACTGCCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186425896_1186425911 30 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425911 X:9464702-9464724 GGGTCCTCTCAGTCCCACGGAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1186425896_1186425904 -1 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425904 X:9464671-9464693 CTGGGTTTGGGATGTGATGGGGG 0: 1
1: 0
2: 2
3: 38
4: 386
1186425896_1186425905 8 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425905 X:9464680-9464702 GGATGTGATGGGGGTAGCCCTGG 0: 1
1: 1
2: 1
3: 14
4: 266
1186425896_1186425901 -4 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425901 X:9464668-9464690 AGGCTGGGTTTGGGATGTGATGG 0: 1
1: 1
2: 2
3: 33
4: 377
1186425896_1186425902 -3 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425902 X:9464669-9464691 GGCTGGGTTTGGGATGTGATGGG 0: 1
1: 0
2: 2
3: 22
4: 360
1186425896_1186425910 27 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425910 X:9464699-9464721 CTGGGGTCCTCTCAGTCCCACGG 0: 1
1: 0
2: 1
3: 28
4: 305
1186425896_1186425903 -2 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425903 X:9464670-9464692 GCTGGGTTTGGGATGTGATGGGG 0: 1
1: 0
2: 0
3: 34
4: 334
1186425896_1186425907 10 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425907 X:9464682-9464704 ATGTGATGGGGGTAGCCCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 194
1186425896_1186425906 9 Left 1186425896 X:9464649-9464671 CCTCGAGGCAGTCGTGGAAAGGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1186425906 X:9464681-9464703 GATGTGATGGGGGTAGCCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186425896 Original CRISPR GCCTTTCCACGACTGCCTCG AGG (reversed) Intronic
900498590 1:2988429-2988451 GCCTTTCCAGGACTGCCACCAGG + Intergenic
903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG + Intergenic
907264257 1:53246749-53246771 GCCATTCCACGAATTCCTCATGG + Exonic
921287615 1:213622999-213623021 GGCTTTCCTGGACTGCCTCTAGG - Intergenic
1074845637 10:117394831-117394853 GAGTTTCCATGACTGGCTCGTGG - Intergenic
1077896291 11:6456160-6456182 TCCCTTCCACGACTGCCTGTGGG + Exonic
1082162447 11:48900422-48900444 GCCCTTCCACGCCGGCCTCTGGG + Intergenic
1083771744 11:64871369-64871391 GCCTTTCCATGACTGACGGGCGG + Intronic
1084937299 11:72593835-72593857 TCCTTTGCAGGACTCCCTCGAGG + Intronic
1085644532 11:78214432-78214454 GCCCCTCCACGCCTGCCTCAGGG + Exonic
1088443194 11:109894758-109894780 GCCTTTCCTCAAATGCCTGGTGG - Intergenic
1088888727 11:114028315-114028337 GCCATTCCCCCACTGCCTCTGGG + Intergenic
1090240138 11:125176051-125176073 GGCTTTCCATGACTTCCTTGTGG + Intronic
1092979303 12:13777624-13777646 GCCTTTCCATCACTGGCTCCTGG + Intronic
1113028987 13:105973223-105973245 CCATTTCCACGATGGCCTCGTGG + Intergenic
1116293838 14:43078520-43078542 TCATTTCCACGTCTGCCTCCTGG - Intergenic
1120455152 14:84720054-84720076 GCCTTTCCCCCACTCCCTAGGGG - Intergenic
1122082401 14:99274649-99274671 GCCTCTCCCCGGCTGCCGCGAGG - Intergenic
1122130529 14:99602629-99602651 GCCTCTCCCCAACTGCCTCTGGG + Intronic
1122398908 14:101455553-101455575 GCCTTTCCCCCACTGTCTCTGGG - Intergenic
1128060545 15:64732807-64732829 GCCTTCCCAGGACAGCTTCGAGG + Intergenic
1132209101 15:100007372-100007394 CCCTTGCCACCACTGCCTTGGGG - Intronic
1135597358 16:23754741-23754763 GCGTTTCCACGCCTCCCCCGGGG - Exonic
1137401304 16:48156258-48156280 GCCTGTCCACGACTGGCGTGGGG + Intergenic
1141922733 16:87146813-87146835 GCCCTTCCACTTCTGCCTCTGGG - Intronic
1150337200 17:64339131-64339153 TCCTTACCACCTCTGCCTCGAGG - Intronic
1152785441 17:82245647-82245669 GCCTTGCCACTCCTGCCTCACGG + Intronic
1152888323 17:82865489-82865511 ACGTTTCCACGCCTTCCTCGTGG + Intronic
927964169 2:27258858-27258880 GCCCTTCCACCACTGCCACAGGG - Exonic
928947227 2:36782313-36782335 GCGTTTCCACGACAGGCTCCTGG + Intronic
929022107 2:37563626-37563648 GCCTTTGCACGTCTGCTTTGAGG + Intergenic
932332416 2:70905223-70905245 ACCTTTCCACGTCTGCCTTGGGG - Intronic
948171744 2:235909140-235909162 GCCTTTCCAGGGCTGCATAGTGG + Intronic
948701680 2:239764595-239764617 CCCTTTCCACTGCTGCCTGGGGG + Intronic
1171204646 20:23269355-23269377 TGCTTTCCACAACTGCCTTGCGG - Intergenic
1175222652 20:57426214-57426236 GACTTTCCACGACAGTCTCCTGG - Intergenic
1175503978 20:59469152-59469174 GCCTCTCCCCGACTGCCTCCAGG - Intergenic
1183352043 22:37339924-37339946 GCCCTTCCACTACTACTTCGGGG - Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185138405 22:49086844-49086866 GCCTCTCCCCGACGGCCTCCTGG - Intergenic
950098980 3:10345860-10345882 GCCTTTCCAGGAAGACCTCGGGG + Intronic
955916692 3:63913561-63913583 ACCTTTCCACGAATGCTTAGGGG + Intronic
958044597 3:88268113-88268135 GCCTTTTCACAAGTGCCTAGGGG + Intergenic
960108863 3:113826097-113826119 GGCTTTCCAGGACTGCCTGTAGG - Intergenic
967187068 3:186953371-186953393 GCCTTTCCACTGCTTCCTCCAGG + Intronic
972479743 4:39486041-39486063 GCCTTTGCAGGATTGCCTCTTGG - Intergenic
985779173 5:1860975-1860997 GCCTTGGCACGACTGCCTGTGGG + Intergenic
990537418 5:56736471-56736493 GCCTTTCCACAGCAGCCTGGGGG + Intergenic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
1018543805 6:164913655-164913677 GCCTTTCCGCAACTGCATGGTGG + Intergenic
1021973389 7:25986702-25986724 GCCTTTCCACAACTTCCTGGAGG - Intergenic
1033340556 7:140488898-140488920 GCCATTGCACTACTGCCTGGGGG + Intergenic
1035781845 8:2233785-2233807 ACCTCTCCACATCTGCCTCGGGG - Intergenic
1035872484 8:3150751-3150773 GCCTTTCCCTGTCTGCCTCCTGG - Intronic
1040532284 8:48275649-48275671 ACCTTTCCATGACTGCCTCTGGG + Intergenic
1045368126 8:101494218-101494240 GCCTTCCCACTCCTCCCTCGTGG - Intronic
1047131810 8:122029546-122029568 GACTTTTCACGACTGGCTTGAGG + Intergenic
1050311036 9:4353506-4353528 GCATTTCCAGAACTGCCTCTGGG + Intergenic
1050671048 9:7997262-7997284 GTCCTCCCTCGACTGCCTCGAGG - Intergenic
1058706008 9:107638257-107638279 GCTTTTGCCCGACTCCCTCGGGG + Intergenic
1186425896 X:9464649-9464671 GCCTTTCCACGACTGCCTCGAGG - Intronic
1187175049 X:16888693-16888715 GCCTTGCCTCCCCTGCCTCGGGG - Intergenic
1195687886 X:107602154-107602176 GCCTGACCACGTGTGCCTCGGGG + Exonic
1202344614 Y:23908346-23908368 TCCTTTCCACAAATGCCTCCCGG + Intergenic
1202526154 Y:25761737-25761759 TCCTTTCCACAAATGCCTCCCGG - Intergenic