ID: 1186426106

View in Genome Browser
Species Human (GRCh38)
Location X:9465255-9465277
Sequence CCCGGAGAGAGCGCGGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 210}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186426106_1186426119 -1 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426119 X:9465277-9465299 GACTCGGCGGCGGCGGGGCGGGG 0: 1
1: 0
2: 3
3: 126
4: 666
1186426106_1186426120 0 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426120 X:9465278-9465300 ACTCGGCGGCGGCGGGGCGGGGG 0: 1
1: 0
2: 5
3: 132
4: 1386
1186426106_1186426126 14 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG 0: 1
1: 3
2: 57
3: 398
4: 2702
1186426106_1186426123 9 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426123 X:9465287-9465309 CGGCGGGGCGGGGGCGGCCCGGG 0: 1
1: 4
2: 29
3: 270
4: 1485
1186426106_1186426124 10 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426124 X:9465288-9465310 GGCGGGGCGGGGGCGGCCCGGGG 0: 1
1: 5
2: 51
3: 334
4: 1974
1186426106_1186426118 -2 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426118 X:9465276-9465298 GGACTCGGCGGCGGCGGGGCGGG 0: 1
1: 0
2: 6
3: 128
4: 1001
1186426106_1186426125 11 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426125 X:9465289-9465311 GCGGGGCGGGGGCGGCCCGGGGG 0: 1
1: 3
2: 37
3: 233
4: 1613
1186426106_1186426122 8 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426122 X:9465286-9465308 GCGGCGGGGCGGGGGCGGCCCGG 0: 2
1: 4
2: 41
3: 368
4: 2376
1186426106_1186426113 -8 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426113 X:9465270-9465292 TCTCCGGGACTCGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 11
4: 125
1186426106_1186426114 -7 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426114 X:9465271-9465293 CTCCGGGACTCGGCGGCGGCGGG 0: 1
1: 0
2: 2
3: 68
4: 510
1186426106_1186426130 30 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426130 X:9465308-9465330 GGGGCGGCGCGCGGCTGCTCCGG 0: 1
1: 1
2: 3
3: 45
4: 352
1186426106_1186426127 21 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426127 X:9465299-9465321 GGCGGCCCGGGGGCGGCGCGCGG 0: 1
1: 3
2: 22
3: 177
4: 1192
1186426106_1186426115 -6 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426115 X:9465272-9465294 TCCGGGACTCGGCGGCGGCGGGG 0: 1
1: 1
2: 1
3: 22
4: 235
1186426106_1186426121 3 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426121 X:9465281-9465303 CGGCGGCGGCGGGGCGGGGGCGG 0: 4
1: 16
2: 121
3: 809
4: 3869
1186426106_1186426117 -3 Left 1186426106 X:9465255-9465277 CCAGCGCCCGCGCTCTCTCCGGG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1186426117 X:9465275-9465297 GGGACTCGGCGGCGGCGGGGCGG 0: 1
1: 0
2: 9
3: 89
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186426106 Original CRISPR CCCGGAGAGAGCGCGGGCGC TGG (reversed) Exonic
900349596 1:2228308-2228330 CCCGGGAGGAGCGGGGGCGCGGG - Intergenic
901526075 1:9824071-9824093 CCCTGGGAGCGCGCGGGCCCGGG + Exonic
902044300 1:13513636-13513658 CTCGGAGCGAGCCCTGGCGCGGG + Exonic
902350156 1:15848166-15848188 CGAGGAGCGAGCGCGGCCGCGGG - Intronic
902990835 1:20186107-20186129 GCAGGACAGAGCCCGGGCGCAGG + Exonic
903297154 1:22350970-22350992 CCAGGAGAGAGGGTGGGGGCGGG - Intergenic
903349721 1:22710640-22710662 CCCGGGGGCAGCGCGGGCGCTGG - Intergenic
904093221 1:27959546-27959568 CCCGGAGAGCACGGGGCCGCTGG - Exonic
904211291 1:28888073-28888095 CCTGGAGCGAGCTCGGGCTCGGG - Intronic
904528932 1:31155350-31155372 CCCGGAGAGGGGGAGGGCGCAGG + Intergenic
904682956 1:32241452-32241474 TCCGGAGAGGACGCGGGCCCTGG + Intergenic
905018417 1:34792893-34792915 GCTGGAGAGAGGGCGGGGGCGGG - Intronic
905308543 1:37034600-37034622 CGCGGAGGGAGCGCGGGCGGCGG - Intergenic
905789796 1:40783966-40783988 CCCGGGGCGGGCGCGGGCGGCGG - Intergenic
905800361 1:40838836-40838858 CCGGGAGTGGGAGCGGGCGCTGG + Exonic
907278147 1:53328145-53328167 GCGGGAGGGAGCGCGCGCGCTGG - Intergenic
908195462 1:61742662-61742684 GGCGGGGAGAGCGCGGGGGCAGG - Intronic
911348257 1:96722116-96722138 CCCGGAGTGGGAGCGGGCACCGG + Intronic
912685157 1:111756222-111756244 CTCGGTGAGAGCGGGGGCCCGGG + Exonic
915477380 1:156161111-156161133 CCCAGTGAGAGCGGGGGAGCGGG + Intronic
916060975 1:161098509-161098531 CCCGGGGAGAGGGAGGGCGGTGG - Exonic
920914907 1:210251750-210251772 CCCAGACAGAGCGCGCCCGCTGG - Intergenic
921946191 1:220887572-220887594 GCAGGAGAGCGCGCGGGCCCCGG + Intergenic
922279968 1:224114274-224114296 TCCGGAGCCAGCGCGGGGGCTGG - Exonic
922753951 1:228083698-228083720 CTCCGAGAGAGCGCTGGGGCCGG - Intronic
923299542 1:232629401-232629423 CCCGGTGAGGGCGCGCGCTCCGG + Intergenic
923463822 1:234231292-234231314 CCCGGGGAGATAGCGGGTGCAGG - Intronic
1063593688 10:7413366-7413388 CCTGGAGAGAGCGCGGTGGCTGG - Intergenic
1064380688 10:14838768-14838790 CCCGGAGACAGCGGGGCCGCTGG + Intronic
1064409997 10:15096969-15096991 CCCGGAGAGAGCGAGCCCTCGGG + Intronic
1064552689 10:16520166-16520188 CCCGGGGACAGCTCGTGCGCTGG - Intronic
1069564040 10:69451471-69451493 CCCGGAGAGAACGCCGGTGGCGG + Exonic
1070329709 10:75408602-75408624 GCCGGGGAGAGCGCGGGGGAGGG + Intergenic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1072591808 10:96833311-96833333 GCCGGAGGGAGCGCGGACGGGGG + Intronic
1073812383 10:107164772-107164794 GGCGGAGCGGGCGCGGGCGCTGG + Intergenic
1074829889 10:117241041-117241063 GCCGGAGGGAGCGGGGGCGGGGG - Intergenic
1076058368 10:127393572-127393594 CCGGGAGAGTGGGCGGGGGCAGG + Intronic
1076182405 10:128420519-128420541 GCAGGAGAGAGAGAGGGCGCAGG + Intergenic
1076757156 10:132578629-132578651 CCAGGAGAGTGTGCGGGGGCTGG + Intronic
1076821592 10:132942496-132942518 CCCGGAGAGAGCGGACGAGCAGG - Exonic
1077106043 11:843065-843087 CTCGGGGAGAGGGCGGGCGGGGG + Intronic
1077392904 11:2308232-2308254 CCTGGGGAGAGCGTGGGCGCTGG - Intronic
1078164554 11:8871035-8871057 CCTGCAGAGAGGGCGGGCGGCGG + Intronic
1080941274 11:36921421-36921443 CCCGGAGAGAGGGGGGTCCCTGG - Intergenic
1081469784 11:43359139-43359161 CCCGGGGCGAGGGCGGGCACGGG - Intronic
1081831474 11:46119884-46119906 CCCGGCGGGGGCGCGGGCGGGGG + Intronic
1084363889 11:68685364-68685386 CGCTGAGAGTGCGCGGGCTCAGG + Intronic
1088462169 11:110093307-110093329 CGCGGAGAGGGCGCGCGGGCGGG + Intergenic
1090264188 11:125343778-125343800 CACGAAGAGGGCGCGGGAGCAGG + Intronic
1091915936 12:4271962-4271984 GGCGGAGGGAGAGCGGGCGCTGG - Intergenic
1094218496 12:27970317-27970339 CGCGGGGCGAGCGAGGGCGCAGG + Intronic
1100611536 12:96194925-96194947 CCCGGCGCGAGCTCGGGCGACGG - Intronic
1101593048 12:106139685-106139707 TTCGGAGAGGGCGCGGGGGCCGG - Exonic
1101692202 12:107093114-107093136 ACCGGAGAAGGCGGGGGCGCCGG + Exonic
1102256640 12:111418932-111418954 CCTGGGGAGAGCGCGGGCTGGGG + Intronic
1102328937 12:112013185-112013207 CTCGGCGAGTGCGCGCGCGCAGG + Intronic
1103659231 12:122500543-122500565 CCGGGCGAGGGCGAGGGCGCGGG - Exonic
1104966146 12:132509582-132509604 CCAGGAGGGACCGCAGGCGCCGG - Intronic
1106057723 13:26254304-26254326 GCCGGAGAGAGCGGCGGAGCCGG + Exonic
1108408084 13:50124573-50124595 GGGGGAGAGAGCGCGCGCGCGGG - Intronic
1108518310 13:51222692-51222714 CCAGGAGAGAGCGGGGGATCCGG - Intronic
1114450476 14:22822181-22822203 CCCGGAGAAAGCGAGGGTGGTGG - Intronic
1114527749 14:23377086-23377108 CCGGGAGAGAAGGCAGGCGCTGG - Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118001242 14:61525900-61525922 CCAGGAGAGAGCACGGCCGGGGG - Intronic
1118312654 14:64704887-64704909 GCCGCAGAGTGCGCGAGCGCAGG + Intronic
1119743307 14:77027817-77027839 CGCGGAGACAGCCCGGGCGGGGG - Exonic
1120167861 14:81220265-81220287 CGCGGGGAGGGCGGGGGCGCCGG - Intronic
1122162182 14:99793009-99793031 CCGGGAGAGAGCGGGCGCGTGGG - Intronic
1122220966 14:100239021-100239043 GGCCGAGCGAGCGCGGGCGCGGG + Exonic
1122719899 14:103716100-103716122 CTGGGAGAGAGCGGGGGCGGGGG - Intronic
1122975313 14:105168493-105168515 CTCGGAGGGCGGGCGGGCGCTGG - Exonic
1126837287 15:52679537-52679559 CCCGGCGGGTGCGAGGGCGCTGG + Intronic
1128067874 15:64775634-64775656 CCGGGGGAGGGGGCGGGCGCCGG + Intergenic
1128582663 15:68820098-68820120 CCCGGGGAGAGCGCGTGGGGAGG - Intronic
1130076707 15:80695655-80695677 CCCGAGGAGGGCGCGGGCGCGGG + Exonic
1132683743 16:1153824-1153846 CCCGGAGAGCCCCGGGGCGCCGG + Exonic
1132846421 16:2002950-2002972 CCCGGAGAGAGCCTAGGCGGTGG - Intronic
1137708006 16:50548588-50548610 CCCGGGGCGAGCGCGCGGGCGGG - Intronic
1139472240 16:67184446-67184468 GCCGGCGCGAGCGCGGGCGCGGG + Exonic
1140462247 16:75148960-75148982 CCCGGCGGGCGCGCGCGCGCGGG + Intronic
1142032843 16:87847003-87847025 CCCGGAGAGAGGGCAAGGGCAGG - Intronic
1142039125 16:87881356-87881378 CCAGGAGAGGGCGGGGGCGGAGG + Intergenic
1142206408 16:88785127-88785149 GCCTGAGCGAGCGCGGGCCCGGG - Exonic
1142690828 17:1605382-1605404 CCCTGGGACAGTGCGGGCGCGGG + Intronic
1143147341 17:4785333-4785355 CCGGGAGAGAGCGGCGGCGGCGG + Exonic
1143749946 17:9021147-9021169 CCGGGGGAGCGCGCGGGCGGGGG - Intergenic
1144021048 17:11240701-11240723 CCGGGAGAGCGCGCGGCGGCTGG - Intergenic
1144828803 17:18120826-18120848 GCCGGGGAGAGCGGCGGCGCGGG - Exonic
1148556608 17:48582262-48582284 CCCAGAGGGGGCGCGGGCGAGGG + Intronic
1149454970 17:56780421-56780443 CCCGGAGCGAGGGCGGGCGCGGG - Intergenic
1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG + Exonic
1151320280 17:73348725-73348747 CCTGGAGAGAGCGGGGGAGTGGG + Exonic
1152461774 17:80445555-80445577 CCCGCCGGGAGCGCGGGGGCGGG + Intergenic
1152468617 17:80478575-80478597 AGCCGAGAGCGCGCGGGCGCGGG + Intergenic
1152545330 17:80997550-80997572 CCTGGACAGAGCGGGGGTGCTGG + Intronic
1152628160 17:81397674-81397696 CCCGGAGAGTGCTCTGGCGAGGG - Intronic
1152741293 17:82019612-82019634 CCCGGAGGGAGCGTGGGCCCTGG + Intronic
1152758862 17:82098120-82098142 CCTGGTGAGGGCGCGGGCGGCGG + Exonic
1153514276 18:5890592-5890614 CCCGGGGAGGGCGGGGGCTCGGG + Exonic
1153688069 18:7566736-7566758 CCGGGAGATGGCGCGGGAGCCGG - Intergenic
1154297814 18:13165641-13165663 CCCGGACAGAACTCGGGCGACGG + Intergenic
1155508235 18:26550965-26550987 CCCGGAGCCAGCGCGGCCCCCGG - Intronic
1160554092 18:79714930-79714952 CCCAGAGGGAGCCGGGGCGCTGG + Exonic
1160719185 19:590060-590082 CCCGGGGGGGGCGCGGGCGGCGG - Exonic
1161114478 19:2489063-2489085 ACCGGAGGGAGCGCTGGCGAGGG - Intergenic
1161153659 19:2721599-2721621 CCCCGAGGGAGGGCGCGCGCAGG - Intronic
1161203699 19:3029372-3029394 GCCGGGGGGGGCGCGGGCGCGGG - Intronic
1161223476 19:3130678-3130700 CTCGGAGCGAGCGGGGGCGGCGG + Intergenic
1162033188 19:7925998-7926020 CCCTGAGAGAGCGCGGCCGCCGG - Exonic
1162315623 19:9936519-9936541 CTCGGAGCGAGCGAGGGGGCGGG - Exonic
1162609518 19:11738569-11738591 CCCAGAGAGGGCGCCGGGGCCGG + Intronic
1162638418 19:11988046-11988068 CCCAGAGAGAGCTCCGGGGCAGG - Intergenic
1162683745 19:12365278-12365300 CCCAGAGAGGGCGCGGGAGCCGG + Intronic
1162954566 19:14090938-14090960 GCCGGAGTGAGCGAGAGCGCAGG - Intronic
1165173187 19:33907264-33907286 CCCGCAGAAACCGCGGGCACTGG + Intergenic
1165243108 19:34482470-34482492 TCCGGGGAGCGAGCGGGCGCGGG - Exonic
1166361881 19:42255853-42255875 CCCGGGGATAGGGCTGGCGCCGG + Intergenic
1166852584 19:45767639-45767661 CCCGGAGGGAGTGTGGGGGCGGG + Intronic
1167134519 19:47608968-47608990 CCCGGAACGGGCGCGGGCCCGGG + Intronic
1167466139 19:49651890-49651912 GCCGGGGCGGGCGCGGGCGCCGG - Exonic
1167648996 19:50719515-50719537 CCCGGAGGGCGAGCGGGCCCGGG + Intergenic
1167657905 19:50778253-50778275 CTCGGGGAGCGCGCGGGAGCTGG + Intergenic
1168280260 19:55301947-55301969 CACGGAGACCGCGCGTGCGCGGG + Intronic
1168465097 19:56595386-56595408 CCCGGGGAGGGCGCGGCCTCGGG + Exonic
931429150 2:62195929-62195951 GCCGCAGGGAGCGCGGGCCCGGG + Intergenic
935196819 2:100820865-100820887 CTCCGAGAGACCGCGGGCCCAGG - Intronic
941508341 2:166375772-166375794 CCCTGAGAGAGCGCCGGGGAAGG - Exonic
941934667 2:170973634-170973656 CCCGGAGACCCCGCGGCCGCTGG - Intergenic
942046634 2:172102779-172102801 CCCAGCGCGAGCGCGGGCTCTGG + Exonic
944414916 2:199471087-199471109 CCAGGAGAGAGCGCGTCAGCGGG - Intronic
947714950 2:232334743-232334765 CCCTGGGAGAGCCCGGGGGCGGG + Intronic
947734025 2:232445694-232445716 CCCTGGGAGAGCCCGGGGGCGGG + Intergenic
948207989 2:236173026-236173048 CGCGCGGTGAGCGCGGGCGCTGG - Intergenic
948394168 2:237632345-237632367 CCCGCAGAGAGCTCCGGAGCAGG - Intronic
948645184 2:239400339-239400361 CCGGGAGTGAGGGCGGGGGCGGG - Intronic
1171123051 20:22582205-22582227 CCGGGAGAGGGCGCCGGCTCTGG + Exonic
1172661719 20:36573421-36573443 CCCGGAGGGGGCGGGGCCGCGGG - Intergenic
1172961990 20:38806203-38806225 CCGGGAGAGTGCGCGGGGGGGGG - Intronic
1173649119 20:44651769-44651791 TCCGGCGAGAGGGCGGGCCCCGG - Intronic
1175424710 20:58855974-58855996 GCCGCAGAGCGCCCGGGCGCAGG - Intronic
1175962246 20:62642927-62642949 CCCGGAGCGCGCGCAGGCGCAGG + Intronic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1178103877 21:29298420-29298442 GCAGGAGAGAGGACGGGCGCTGG - Intronic
1179150687 21:38806025-38806047 CCGGGCGAGGGCGAGGGCGCCGG - Exonic
1180609515 22:17086010-17086032 CCCGGTGAGAGCGCAGTCGGAGG + Intronic
1180959642 22:19756831-19756853 CCCGGAGGGAGCGCGCCCGTCGG - Intronic
1181160474 22:20957170-20957192 CCCGGACTGAGCGCGGGGGCTGG - Intergenic
1181444530 22:22958776-22958798 CCAGCAGAGAGGGCGGACGCTGG - Intergenic
1183702228 22:39457270-39457292 CCCGGCGAGCGGACGGGCGCGGG - Intergenic
1184843148 22:47064195-47064217 CACAGAGAGAGCACGGGTGCCGG - Intronic
1185055284 22:48575915-48575937 GCCGGAGCGAGCGCGGGCGGCGG + Intronic
1185255119 22:49827522-49827544 CCCGGCAAGCGGGCGGGCGCGGG + Intergenic
1185343054 22:50300067-50300089 CCCCGGGAGGGCGCGGGCGGTGG - Intronic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
949089561 3:11428-11450 CGCAGAGAGGGCGCGCGCGCCGG + Intergenic
950345326 3:12287854-12287876 CCCGGCGCGGGGGCGGGCGCGGG - Intronic
953027457 3:39153310-39153332 CCCTGAGCGGGCGCGGGGGCTGG - Intronic
954660460 3:52224273-52224295 CCAGGAGAGACAGCGGGTGCAGG + Exonic
954778864 3:53045320-53045342 CCCGGAGCGAGCCCGGGGGGCGG + Intronic
955356643 3:58237681-58237703 CCCAAACAGAGCGCGGCCGCTGG + Exonic
956468633 3:69542621-69542643 CCCGGAGAGGCGGCGGGCGGGGG - Intergenic
958779409 3:98522966-98522988 CCCGGAGTGGGGGCGGGCGGAGG - Intronic
960582703 3:119294506-119294528 CCCGGAGACGACGCGGACGCGGG - Exonic
961322142 3:126083778-126083800 CCGGGAGAGAACCCAGGCGCTGG - Intronic
963888067 3:150603205-150603227 CCAGGAGTGTGCGCGGGCGCCGG + Intronic
965590609 3:170357564-170357586 CCGGGGGAGAGCGAGGGCGGCGG - Intergenic
966712023 3:182980711-182980733 CCCGGGGAGTGGGCGGGGGCGGG + Intronic
967694416 3:192514893-192514915 GCCGGAGGGAGCCCGGGCGCCGG + Intronic
967890107 3:194358957-194358979 CCCGGAGGGGGCCTGGGCGCAGG + Exonic
968659714 4:1793948-1793970 CACGCAGAGCGCGAGGGCGCAGG - Exonic
968919386 4:3514822-3514844 CACGCAGAGAGCGTGGGCGACGG - Exonic
969330327 4:6470956-6470978 CGCAGCGCGAGCGCGGGCGCGGG - Intronic
972396860 4:38664766-38664788 CCCGGGCAGGGCGCGGGCGGGGG + Intronic
972675569 4:41257032-41257054 CCCGGAGAGCGCGAGGCCGAGGG + Intronic
973982222 4:56316125-56316147 ACCGGAGACAGCGCGGATGCAGG + Exonic
979231378 4:118352477-118352499 CCTGGAGGGCGTGCGGGCGCTGG + Exonic
985073452 4:186191046-186191068 CCCGGAGAGCACGCAGGGGCGGG - Intergenic
985558123 5:568118-568140 CCCGGAGAGAGCGTGGCTGCAGG + Intergenic
990376559 5:55176526-55176548 GCGGGAGCGGGCGCGGGCGCGGG - Intergenic
991054519 5:62306589-62306611 CACGGAGGGGACGCGGGCGCCGG + Intronic
1001342846 5:170862654-170862676 CCCGGGCCGGGCGCGGGCGCGGG + Intronic
1004864346 6:19838192-19838214 CCCGGTGAGAGGCCGGGCGCCGG + Exonic
1005826168 6:29632864-29632886 CCCGGGGAGAGCCGGGGAGCCGG - Exonic
1006547551 6:34792291-34792313 CCCGGTGAGAGCGCCAGCGCCGG + Exonic
1006725576 6:36196991-36197013 GCCGGACAGAGCGGGGGCGGGGG + Intronic
1006932501 6:37696604-37696626 CCTGGAGAGGGCGGGGACGCGGG + Intronic
1007834263 6:44662716-44662738 CCAGGACAGAGCCCGGGCCCGGG - Intergenic
1008369272 6:50714692-50714714 CCCGAAAAGAGCGCTGGCCCGGG - Intronic
1011649429 6:89492179-89492201 TCTGGAGAGAGCGCCGGGGCTGG + Intronic
1013220724 6:108074868-108074890 GCTGGAGAGCGCGCGGCCGCAGG - Intronic
1015149257 6:130019942-130019964 CCGGGTGCGGGCGCGGGCGCGGG + Intronic
1015366232 6:132401087-132401109 CCCAGAGAGGGCGCAGGTGCGGG - Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1017282131 6:152636856-152636878 GCCAGGGTGAGCGCGGGCGCCGG - Intronic
1019989629 7:4682492-4682514 CCGGGCGCGATCGCGGGCGCGGG + Exonic
1021231037 7:18086686-18086708 CGCGGCGAGAGCGCGGGCCCAGG - Intergenic
1022310812 7:29194534-29194556 CCAGGAGAGGGTGCGGGAGCTGG + Exonic
1026009884 7:66628676-66628698 CTCGGAGAGGGCGCGCCCGCTGG + Intergenic
1026878840 7:73895198-73895220 CCCGTGCAGGGCGCGGGCGCAGG - Intergenic
1029595256 7:101534197-101534219 CCCGGAGAGAGCTCTGCCTCAGG - Intronic
1031447534 7:121873069-121873091 CCTGGAGGGGGCGGGGGCGCAGG - Exonic
1033270604 7:139929814-139929836 CCAGGAGAGAGCGGGGGTGGAGG - Intronic
1035717499 8:1764664-1764686 GCGGGGGAGAGAGCGGGCGCTGG + Intronic
1037819968 8:22130772-22130794 CCCGGAGGGAGAGAAGGCGCCGG + Exonic
1039965506 8:42280941-42280963 CCCTGACAGAGCTCGGGCCCAGG - Intronic
1040443815 8:47473046-47473068 CCTGGAGAGAGTGCAGGGGCTGG - Intronic
1040587325 8:48756245-48756267 GCCGGAGAGCGCGGGAGCGCCGG + Intergenic
1041648708 8:60280819-60280841 CCGGGTGAGAGCGCAGGCGGCGG + Intronic
1045509971 8:102806562-102806584 CGGGGAGAGAGCGCGGCCTCCGG - Intergenic
1047961732 8:130016277-130016299 CCCGGAGAGGGCGCGGGGTGCGG - Intronic
1049441711 8:142612629-142612651 CCGGGAGAGGGCGGCGGCGCCGG + Exonic
1049608464 8:143541049-143541071 CGCGGGGAGAGAGTGGGCGCCGG + Intronic
1049762623 8:144337968-144337990 CCCGGGGAGCGTCCGGGCGCGGG + Intergenic
1049828581 8:144685667-144685689 GCCGGTGAGAGCGCGGGCAACGG - Intergenic
1054258425 9:62838375-62838397 CGCGGAGGGGGCGCCGGCGCAGG - Intergenic
1057212488 9:93207759-93207781 CCTGGAGAGGGCGTGGGTGCCGG - Intronic
1057361197 9:94374922-94374944 ACCTGGGTGAGCGCGGGCGCGGG + Exonic
1057662166 9:97013242-97013264 ACCTGGGTGAGCGCGGGCGCGGG - Exonic
1060485886 9:124045846-124045868 CGCGGAGAGAGCCCGCGCGGTGG + Intergenic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1061823083 9:133239290-133239312 CCCGGGGTAAGGGCGGGCGCTGG - Intergenic
1061976003 9:134068224-134068246 CCCGGGGGGCGCGCGGGGGCGGG + Intronic
1061976097 9:134068531-134068553 CCTGGCGGGAGCGCGCGCGCGGG + Intronic
1062567198 9:137168555-137168577 CCCGGAGCGAGGGCGGGGGCGGG - Exonic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1187172929 X:16869774-16869796 GCCGGAGGGAGCGCAGCCGCTGG + Exonic
1187533374 X:20116350-20116372 CGCAGAGAGAGCGCGCGCGGAGG + Intronic
1190024903 X:46913317-46913339 CCCGGCGGGAGCGGGAGCGCGGG + Intronic
1190745847 X:53321272-53321294 CCGGGAGACAGCGCTGGGGCCGG + Exonic
1192583988 X:72306190-72306212 GCTGGAGAAAGCGCGGGCGCAGG + Intronic
1198530613 X:137547427-137547449 GCCGGGGAGAGCGCGGCTGCCGG + Intergenic
1200128967 X:153830803-153830825 CGAGGCGGGAGCGCGGGCGCTGG - Intergenic
1200218272 X:154378439-154378461 CCCTAAGAGAGCGCGGGCCCCGG - Intergenic