ID: 1186428987

View in Genome Browser
Species Human (GRCh38)
Location X:9488396-9488418
Sequence GCTCCTCTGCAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186428987_1186428991 10 Left 1186428987 X:9488396-9488418 CCTTCCTCCATCTGCAGAGGAGC 0: 1
1: 0
2: 4
3: 54
4: 518
Right 1186428991 X:9488429-9488451 CTCTCTGACTGTCCTTCCATAGG 0: 1
1: 0
2: 1
3: 23
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186428987 Original CRISPR GCTCCTCTGCAGATGGAGGA AGG (reversed) Intronic
900021643 1:189761-189783 GCTGCTCTGCACATGGAGTGTGG - Intergenic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
900476169 1:2877416-2877438 GCTTCTCGGAGGATGGAGGAAGG - Intergenic
900590955 1:3459599-3459621 GGCCCTCTGGAGAGGGAGGACGG + Intronic
901446398 1:9310741-9310763 ATTCCTCTGCAGATGGGGGTTGG + Intronic
901471529 1:9460018-9460040 GCTGCTTTGAGGATGGAGGAAGG - Intergenic
901674130 1:10872997-10873019 CCTCCTCTGCTGATTGAGGCTGG + Intergenic
902007628 1:13244994-13245016 GCTACTCTGCACATGGAGGTGGG - Intergenic
902026602 1:13388793-13388815 GCTACTCTGCAGACAGAGGTGGG - Intergenic
902041960 1:13499208-13499230 GCTACTCGGGAGATGGAGGCAGG - Intronic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
903358352 1:22761888-22761910 GCTCCCCAGCAGAGGGAGGGGGG + Intronic
903816183 1:26066171-26066193 GATCCTGAGCAGATGAAGGAGGG + Intronic
904453921 1:30635637-30635659 GCTCATCTGCAGATGGCCTATGG + Intergenic
904606110 1:31698601-31698623 ACTCTTCTGGAGATGGAGCAGGG + Exonic
904703983 1:32376736-32376758 GCTCCTCTGTAGAGAGAGAAAGG + Exonic
905049668 1:35039198-35039220 GCTACTCAGCAAATGGAGGCAGG + Intergenic
905297085 1:36961126-36961148 TCTCCCCTGCACATGGAGGTAGG + Intronic
905324068 1:37138000-37138022 GCTCTTCTGCTGAAGAAGGAAGG - Intergenic
905570171 1:38997602-38997624 GCTACTCTGCAGGGGGAGGCGGG - Intronic
905619056 1:39425355-39425377 GTTCATCTGCAGCTGGGGGATGG - Intronic
905656564 1:39689787-39689809 GCTCCTCTGAAGCTGGGTGAGGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907748468 1:57238622-57238644 GCTCCTCTTAGGATGCAGGAAGG - Intronic
910229923 1:84974941-84974963 TCTCCTCTGCTTTTGGAGGAGGG + Intronic
910418964 1:87035039-87035061 GATGCTGTGCAGCTGGAGGATGG + Intronic
912434344 1:109649500-109649522 TCTGCTCTGCAGATGGAAAATGG + Intergenic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
912882933 1:113436924-113436946 GCTACTCTGGAGGTGGAGGCAGG - Intronic
913373736 1:118129094-118129116 GCTCCTACACAGATGAAGGAAGG + Intronic
913505238 1:119510852-119510874 GCTACTCTGCAGACTGAGGTGGG - Intronic
914049335 1:144118700-144118722 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
914129849 1:144846744-144846766 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
914216804 1:145638386-145638408 GCTACTCAGGAGATGGAGGCAGG + Intronic
914469372 1:147961067-147961089 GCTACTCAGGAGATGGAGGCAGG + Intronic
915080373 1:153348010-153348032 GATGCTCTGCAGATTGAGAATGG - Intronic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916427380 1:164693564-164693586 GCTCCCCTGCCGATGGAAAATGG - Intronic
918045858 1:180940821-180940843 GCTACTCGGGAGATGGAGGCGGG - Intronic
918047123 1:180948216-180948238 GACCCTCTGCTGTTGGAGGATGG - Exonic
918843988 1:189584703-189584725 GCTACTCTGGAGACTGAGGAGGG + Intergenic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919688530 1:200507425-200507447 GCTACTCTGGAGACGGAGGTGGG - Intergenic
920851728 1:209632658-209632680 GCTCCCCTGCAGACGGAGCTGGG + Exonic
921952665 1:220946610-220946632 GCTCCTCTGCCAATGGAGAATGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922703924 1:227779032-227779054 GCCCCTCTGCAGATGGCACAGGG - Intronic
924456143 1:244220125-244220147 GCTCATCTGCAGGTTCAGGAAGG + Intergenic
924496608 1:244596361-244596383 GCTGCTCTGTAGACGGAGCAGGG - Intronic
924712361 1:246539965-246539987 GCTACTCAGGAGGTGGAGGAGGG - Intergenic
1062942931 10:1438311-1438333 TCTCCTTAGCAGATGGAGGCAGG + Intronic
1062942941 10:1438357-1438379 TCTCCTCAGCAGATGGAAGGAGG + Intronic
1062942950 10:1438403-1438425 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942979 10:1438539-1438561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942989 10:1438585-1438607 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943021 10:1438721-1438743 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943041 10:1438812-1438834 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943072 10:1438948-1438970 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943103 10:1439084-1439106 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943123 10:1439175-1439197 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943139 10:1439266-1439288 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943160 10:1439357-1439379 TCTCCTCAGCAGGTGGAGGCAGG + Intronic
1062943183 10:1439448-1439470 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943203 10:1439539-1439561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943224 10:1439630-1439652 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943233 10:1439676-1439698 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943242 10:1439722-1439744 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943262 10:1439813-1439835 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943311 10:1440041-1440063 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943319 10:1440087-1440109 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1063246442 10:4224497-4224519 GCTCCTCTGGAGGTTGAGGCAGG + Intergenic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1064266471 10:13829547-13829569 GCTCCTGTGAAGATTGAGAAGGG - Intronic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1065241755 10:23712203-23712225 GCTTCTCTGCAGTTTGAGGGTGG + Intronic
1065942002 10:30573461-30573483 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067565258 10:47331594-47331616 GCTCCTCTGCAGATGAGGAAGGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069850987 10:71404851-71404873 GGTCCTCTCCAAATGGAGCATGG - Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070249262 10:74759619-74759641 GCTACTCTGGAGGTTGAGGAGGG + Intergenic
1070835762 10:79445892-79445914 GCTCATCTGCATATGCAGCACGG + Intergenic
1071505516 10:86229259-86229281 GCTCCTCTGCCCTGGGAGGAGGG - Intronic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1072418403 10:95268821-95268843 TCTCCTCTGGTGACGGAGGAAGG - Exonic
1072761976 10:98064057-98064079 GCCGCTCTGCAGTTTGAGGAAGG + Intergenic
1074050580 10:109877737-109877759 GCTCCTGTGCAGAAGCAGCAAGG + Intronic
1075047355 10:119156598-119156620 GTGCCTCTGGAGATGAAGGAAGG + Intronic
1075715705 10:124554022-124554044 ACTCCACTGCAGATAGAAGAAGG + Intronic
1076484473 10:130807291-130807313 GTTCCTCTGAAGAGGGAGGTGGG - Intergenic
1076563482 10:131382419-131382441 ACTGCTCTGAAGGTGGAGGATGG - Intergenic
1076873299 10:133204035-133204057 GCACCTCTGCAAATGGATGGGGG + Intronic
1077415115 11:2421195-2421217 GCTCCTGTGGGGATGGAAGAGGG + Exonic
1077505309 11:2927405-2927427 GCCCCTGTGCAGATCGGGGAGGG - Intergenic
1078141297 11:8694948-8694970 GCTACTCAGGAGGTGGAGGAGGG + Intronic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080547325 11:33333548-33333570 CATCCACTGGAGATGGAGGAAGG + Intronic
1080752587 11:35164693-35164715 TCTCCTCTGCAGAGTGAGCAAGG + Intronic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081602569 11:44505464-44505486 CCACCTTTGGAGATGGAGGAAGG + Intergenic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1084226737 11:67720187-67720209 GCTACTCAGGAGATGGAGGCAGG + Intergenic
1084314352 11:68336032-68336054 GCCTCTCTGCTGATGGAGGTAGG - Intronic
1084652220 11:70495918-70495940 GCACCTGTGGAGATGCAGGAAGG + Intronic
1084709087 11:70832880-70832902 GCTGCTCTGCAGATGCAGTGAGG - Intronic
1084709094 11:70832966-70832988 GCTGCTCTGCAGATGCAGTGAGG - Intronic
1085525641 11:77161947-77161969 CCTCCTCTGCACCTGGAGGGAGG + Intronic
1085992560 11:81867908-81867930 GCACGTCTCCACATGGAGGAAGG + Intergenic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1087439217 11:98161484-98161506 GCTCCTCTGCCAATGGAGTCTGG - Intergenic
1088011238 11:105003362-105003384 GCTCTTCTGCAAATCGAGGCTGG - Exonic
1088220874 11:107569260-107569282 GCTACTCTGGAGGTCGAGGAAGG - Intergenic
1088288198 11:108208474-108208496 GCTGCTCTGGAGGTGGAGGTGGG + Intronic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG + Intergenic
1088890796 11:114042623-114042645 GCTCCTCTCCAAATGGCCGATGG - Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090282441 11:125467726-125467748 GCTACTCAGGAGATGGAGGTGGG + Intronic
1090593626 11:128297150-128297172 GCTCCTCTGCAGCTGGAGCTGGG - Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1091750200 12:3017574-3017596 GCTCTTCTGAACAGGGAGGAGGG - Intronic
1092503797 12:9074288-9074310 GCTCCACTGCTGCTTGAGGAAGG + Intronic
1092556129 12:9563821-9563843 GCTACTCAGAAGATGGAGGCAGG + Intergenic
1092875776 12:12846431-12846453 GCTACTCTGGAGATTGAGGTGGG - Intergenic
1093368316 12:18332625-18332647 GCTCCTTTGCTGTTGAAGGAAGG - Intronic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1093985579 12:25528728-25528750 GCTTCACTGCAGATGGAAGAAGG - Intronic
1094215776 12:27940462-27940484 GCTACTCAGCAGATGGAGGCAGG - Intergenic
1094515962 12:31126828-31126850 GCTACTCGGAAGATGGAGGCAGG - Intergenic
1094576217 12:31688064-31688086 GCTACTCGGGAGATTGAGGACGG - Intronic
1096475971 12:51909025-51909047 GCTCCTCTGCTGTTGGGGTAAGG + Intronic
1096677643 12:53234133-53234155 GCCCCTCTACAGAAGGAGAAGGG - Intergenic
1096737858 12:53669900-53669922 GCACCACTGCAGATAGCGGACGG + Exonic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1099005980 12:77235274-77235296 GTTCCTCTGGAGAGGCAGGATGG + Intergenic
1099764275 12:86961677-86961699 GCACAGCTGAAGATGGAGGAGGG + Intergenic
1101777478 12:107807399-107807421 GCTCTTCTTCAGAGGGATGATGG + Intergenic
1102097050 12:110249277-110249299 GCTTCTTTCCACATGGAGGACGG - Intergenic
1102497274 12:113328463-113328485 GCTCTTCAGCAGCTGGAGGAGGG - Intronic
1102536057 12:113582493-113582515 TCTCCTCTGCAGATGGAGTCAGG + Intergenic
1102558155 12:113742505-113742527 GCCCCTCTGCAGATGGGTGGAGG - Intergenic
1102645342 12:114400153-114400175 GGTCCTCTGCCGCTGGAGGAAGG + Intronic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102954218 12:117048924-117048946 GCGCCTCTGCAGCAGGAGGCTGG - Intronic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103393909 12:120593323-120593345 GCTCCTCAGAAGACTGAGGAAGG - Intergenic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1104276863 12:127337003-127337025 CCACCTCTGCAGCTGGAGGTGGG - Intergenic
1104365086 12:128169554-128169576 GTATCTCTGCAGATGGATGAGGG - Intergenic
1104769789 12:131354172-131354194 ACTCCTCAGCAGAGGCAGGATGG - Intergenic
1105629291 13:22145439-22145461 GCTACTTTGCAGATTGAGGTAGG + Intergenic
1106103628 13:26715351-26715373 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1107559257 13:41545541-41545563 TCTCATCTTCACATGGAGGAGGG + Intergenic
1109444306 13:62413217-62413239 GCTCCTCTGCAGGCTGAGGCAGG + Intergenic
1109839678 13:67905472-67905494 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
1110888260 13:80666221-80666243 CACCCTCTGCAGATAGAGGAGGG + Intergenic
1111383705 13:87495271-87495293 GCTCCTCTGGGGATGGAATAGGG + Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1112493709 13:99888974-99888996 GCATCACTGCAAATGGAGGATGG - Intronic
1112746696 13:102534992-102535014 CATCCTCTGCAGGTGGATGAAGG + Intergenic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113408744 13:110065290-110065312 GCTGCTTTGAAGATGGAGGGAGG - Intergenic
1113496163 13:110730961-110730983 GCTCCTCTGCAGTTAAGGGAGGG - Intergenic
1113574608 13:111385734-111385756 GCTCCTCAACAGAGGGAGGAGGG + Intergenic
1114084590 14:19230142-19230164 GCTACTCAGCAGACGGAGGCAGG - Intergenic
1114237290 14:20834229-20834251 GGTCCTCTGCAGAGGGGGCATGG + Intergenic
1114497118 14:23140515-23140537 GCTCCTTTGCCTATGGAGGCTGG - Exonic
1114869537 14:26639607-26639629 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1115164956 14:30437760-30437782 GCTGCTCTGGAGATTGAGGCAGG + Intergenic
1115961360 14:38838175-38838197 GCGCCTCTGCACCAGGAGGAAGG + Intergenic
1116794365 14:49374029-49374051 GCACCACTGCAGATAGTGGATGG - Intergenic
1117041066 14:51769492-51769514 GCTGCTCAGGAGATGGAGGCAGG + Intergenic
1118630722 14:67700026-67700048 GCTCCTTGGGAGATGGAGGCAGG + Intergenic
1118847183 14:69556369-69556391 GCTACTCTGGAGATTGAGGCAGG + Intergenic
1118941895 14:70346463-70346485 GGTCCTCTGCAGAGGGGGCATGG - Intronic
1118985430 14:70750594-70750616 GCTACTCGGCAGGTGGAGGCAGG - Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119171859 14:72541665-72541687 GCTACTGTGCGGGTGGAGGATGG + Intronic
1119622068 14:76138744-76138766 GCGCCTCTCCAGAGGGGGGAAGG + Intergenic
1120030630 14:79636810-79636832 GCTCCTCTGCCAAAGGAGCATGG + Intronic
1120031730 14:79649336-79649358 GCTCTTCTCCTGATGGAAGAGGG + Intronic
1120202504 14:81553294-81553316 GCTCCTCAGGAGGTGGAGGCAGG - Intergenic
1120997112 14:90425454-90425476 GCTCCTCTGCAGATGAAACAAGG + Intergenic
1121812557 14:96904127-96904149 GCTCCTCTGTACATGAAGGCAGG + Intronic
1121878539 14:97477890-97477912 GCTTCTCTGGAAATGGAGGTGGG - Intergenic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1202838940 14_GL000009v2_random:102356-102378 GCTCCTCTGGAGTTTGAGGCAGG - Intergenic
1123419271 15:20118271-20118293 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1123433818 15:20240228-20240250 GCTACTCAGCAGGTGGAGGCAGG + Intergenic
1123528493 15:21124814-21124836 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1124231924 15:27953319-27953341 GCCCCACTGCACATAGAGGAGGG - Intronic
1125184894 15:36919066-36919088 GCTACTCTGCAGACTGAGGTGGG + Intronic
1126169212 15:45680525-45680547 GCTCCTCAGGAGATTGAGGTAGG - Intronic
1126241760 15:46453262-46453284 GTTCTTCTGCACTTGGAGGAGGG - Intergenic
1126571202 15:50153448-50153470 GCTACTCAGGAGATGGAGGCAGG - Intronic
1127834664 15:62781128-62781150 TCTCCTCTGTAGCTGGATGAAGG + Exonic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128291988 15:66485085-66485107 GCTCCTTGGCATCTGGAGGAGGG - Exonic
1128546913 15:68574469-68574491 GCTACTCTACAGAGTGAGGAGGG - Intergenic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129522828 15:76196537-76196559 GCTACTCTGGAGATGAAGTAAGG + Intronic
1130585526 15:85178089-85178111 GCTACTCAGGAGATGGAGGTGGG - Intergenic
1132584091 16:698586-698608 GCTCCTGTGCATGTGGAGGGTGG - Intronic
1132609663 16:809122-809144 GCTACTCTGCAGACTGAGGCAGG - Intronic
1132679966 16:1135814-1135836 GCACCTCGGCAGGTGGAGGCAGG - Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133123400 16:3626981-3627003 GCTCCTCAGAAGACGGAGGCAGG - Intronic
1133273464 16:4623046-4623068 GCTACTCTGGAGGTGGAGGCAGG - Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1134015327 16:10884158-10884180 GCTTCTCAGCAGTTGGAGGCAGG - Intronic
1134046471 16:11104608-11104630 ACTTCTCTCCAGAGGGAGGAAGG + Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134359719 16:13520013-13520035 GCACCTATCCAGATGGAAGAAGG + Intergenic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134477756 16:14590521-14590543 GCTCCTCAGCAGTCTGAGGAAGG + Intronic
1134764419 16:16744257-16744279 GTTGCTTTGAAGATGGAGGAAGG + Intergenic
1134803126 16:17103856-17103878 GACCCTCTTAAGATGGAGGAGGG - Exonic
1134981639 16:18614957-18614979 GTTGCTTTGAAGATGGAGGAAGG - Intergenic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136350884 16:29706838-29706860 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1136425611 16:30168056-30168078 GCTACTCTGGAGGTGGAGGCAGG + Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1139590102 16:67928631-67928653 CCTCCTCTGCAGCTGCACGAAGG + Exonic
1139947948 16:70654435-70654457 TCTCCTATGCAAATGGATGATGG + Intronic
1140457487 16:75113657-75113679 TCTCCTCTGCAGTTGGGGAAGGG + Exonic
1140944078 16:79751218-79751240 GCTGGTTTGAAGATGGAGGAAGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141746678 16:85930893-85930915 GCTCCTTTACAGATGAGGGAAGG - Intergenic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1203137824 16_KI270728v1_random:1740454-1740476 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1142747493 17:1967144-1967166 GCTCCTCCCCAGAAGGAAGAGGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143376403 17:6470184-6470206 CCTCCTCTCCAGCTGGAGAAGGG + Intronic
1143780795 17:9228273-9228295 GCTCCTCGGTGGAGGGAGGAAGG + Intronic
1145773336 17:27509108-27509130 GATCCTCTGCAGAGTGAGCAAGG + Intronic
1147121148 17:38335810-38335832 GCTCCTCTGCAGAATGAAGGTGG - Intronic
1147179696 17:38676433-38676455 GCTCTTCTGCAGATGTTAGAGGG - Intergenic
1147381224 17:40057355-40057377 GCTGCTCGGGAGATGGAGGTAGG + Intronic
1147912039 17:43861660-43861682 GTGCCTCTGCAGATGGACGGAGG + Intronic
1147931151 17:43982400-43982422 TCTCCTCTACTGATTGAGGAAGG + Intronic
1147962894 17:44178439-44178461 GGTCCTCCGCAGTTGGAGGCGGG - Exonic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1148764489 17:50029150-50029172 GCTCCTCTCTTGTTGGAGGAGGG + Intergenic
1148978162 17:51547675-51547697 GCTCCCTTGGAGATGGAGGAGGG - Intergenic
1149655636 17:58308427-58308449 CCACCTCTGCTGATGGAGGCAGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151691157 17:75686402-75686424 GCTACTCTGGAGGTTGAGGAAGG + Intronic
1151939449 17:77283292-77283314 GCCCCTCTGAGGATGGGGGAAGG + Intronic
1152171759 17:78755285-78755307 GCTACTCTGGAGGTGGAGGCAGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1154074588 18:11187791-11187813 CCAGCTCGGCAGATGGAGGAGGG + Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1157014833 18:43699630-43699652 GCTCCTCTGCCAGTGGAGGTTGG + Intergenic
1157188063 18:45557599-45557621 GCTTCTCTGGAGTTGGATGACGG + Intronic
1157442670 18:47722473-47722495 ACACCTCTGCAGGTAGAGGAAGG + Intergenic
1157449061 18:47772077-47772099 GGTCCACTGCACATGGAGGGTGG + Intergenic
1157722638 18:49937174-49937196 GCCTCTCTGTAGATGAAGGATGG - Intronic
1158032962 18:52989409-52989431 GCTACTCAGGAGATGGAGGCAGG + Intronic
1158033738 18:52999448-52999470 GCTTCTGTGCGGATGGAGCATGG + Intronic
1158551493 18:58439905-58439927 GCTACTCTGGAGACTGAGGAAGG - Intergenic
1158582020 18:58691930-58691952 GCTACTCAGGAGATGGAGGCAGG + Intronic
1159383488 18:67691845-67691867 ACTCCTCAGGAGATGGAGGTGGG - Intergenic
1159650712 18:70974278-70974300 GCTCCTCTGGAGGCTGAGGAAGG - Intergenic
1160136786 18:76278732-76278754 GCTACTCTGGAGATTGAGGCAGG + Intergenic
1160633675 19:60846-60868 GCTGCTCTGCACGTGGAGTATGG - Intergenic
1161487048 19:4542134-4542156 GCTCCTATGCAGATGAAGATGGG + Intergenic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1163418977 19:17203704-17203726 GCTCCTCCGGTGATGGTGGACGG - Intronic
1166444971 19:42851044-42851066 GCTCCACAGCAGGTTGAGGATGG + Intronic
1167807637 19:51799693-51799715 GCTCCCCAGCAGCTGCAGGAGGG + Intronic
1167889682 19:52529268-52529290 GCTGCTCTGGAGGTGGAGGTAGG + Intronic
1167905866 19:52660207-52660229 GCACCTCTGCAGCTGGGGGTAGG + Intronic
1168552258 19:57306280-57306302 CATCCTCTGAAGGTGGAGGATGG - Intergenic
1202688783 1_KI270712v1_random:71595-71617 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
924965586 2:73572-73594 GGTCCACTGCAGATTTAGGAAGG + Intergenic
927262222 2:21102963-21102985 GCTCCTCTGCCAATGGAGCTTGG + Intergenic
927703910 2:25285546-25285568 ACTCCTCAGCAGTTGGAGGCAGG + Intronic
927896896 2:26788566-26788588 GCTCCTCTGTAGGTGAAAGAAGG - Intronic
927940806 2:27101744-27101766 GCTCCTGAGGAGATGGAGCAAGG + Exonic
928563838 2:32521578-32521600 GCTACTCTGCAGACTGAGGCAGG - Intronic
928679104 2:33680755-33680777 CCTCCACTGCAGGTGGAGGGTGG + Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
932351043 2:71032193-71032215 GCTGCTCAGGAGATGGAGGCAGG - Intergenic
932461484 2:71884769-71884791 GCTCCCCTGCAGGTAGAGCAGGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933731222 2:85457653-85457675 GCTACTCTGGAGATTGAGGCAGG + Intergenic
933957652 2:87384504-87384526 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
934241772 2:90276399-90276421 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
934271400 2:91540286-91540308 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
934879211 2:97958893-97958915 GCTCCACTGCTGCTGGAGGGAGG - Intronic
936139462 2:109926696-109926718 GCTACTCTGGAGACTGAGGATGG + Intergenic
936205234 2:110444790-110444812 GCTACTCTGGAGACTGAGGATGG - Intronic
936567799 2:113594167-113594189 GCTGCTCTGCACATGGAGTGTGG + Intergenic
936998757 2:118442226-118442248 GCTTCTCTGCAAGTGGAAGAAGG - Intergenic
937619901 2:123973317-123973339 GCTACTCTGGAGGTGGAGGTGGG + Intergenic
937643162 2:124236354-124236376 GCTCCTGGGCAGGTGCAGGAAGG - Intronic
938041258 2:128078028-128078050 GCTACTCTGGAGGTGGAGGTGGG + Intergenic
938792173 2:134686279-134686301 CCTCCACAGCAGGTGGAGGAAGG + Intronic
940300238 2:152169386-152169408 GCTACTCGGGAGATGGAGGTGGG - Intronic
941835836 2:170019571-170019593 GCTACTCAGGAGATGGAGGTGGG + Intronic
941993459 2:171578947-171578969 GCTCCTCAGGAGACGGAGGCAGG - Intergenic
942395343 2:175541319-175541341 GCTCCTCAGGAGGTGGAGGCAGG - Intergenic
943564067 2:189496769-189496791 GCCCCTCTCCAGAAGGTGGAAGG - Intergenic
943739062 2:191391188-191391210 GCTCCTCTGCAGGCTGAAGAAGG + Intronic
944206672 2:197164469-197164491 GCTGCTCTTCAGCTGGGGGAAGG - Intronic
944751942 2:202718022-202718044 GCTCCTCTGCCTATGGAAAAGGG - Intronic
945300124 2:208208265-208208287 GGTCCTCTTCAGATTGATGATGG - Intergenic
945682179 2:212927263-212927285 ACTCTTCTGCAAATGGAGGGAGG - Intergenic
946740923 2:222800345-222800367 GCGCCTGGGCACATGGAGGAAGG + Intergenic
947386168 2:229592714-229592736 GCTCCTCTTCAGATAGCGCAAGG + Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
948442589 2:238004885-238004907 CTCCCTCTGGAGATGGAGGAAGG + Intronic
948504212 2:238417209-238417231 GCTACTCAGGAGATTGAGGAGGG - Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948602764 2:239116686-239116708 GCTCTTCAGCAGAGGCAGGATGG - Intronic
948643637 2:239390611-239390633 GCTCCTCCACAGGTGGAGGGTGG - Intronic
948766081 2:240219804-240219826 GCTCCTCGGATGAGGGAGGATGG - Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1172022550 20:31924693-31924715 GCTACTCTGGAGATTGAGGCAGG - Intronic
1172107745 20:32526936-32526958 GCCCCTCTGCAGGGTGAGGAGGG + Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174856655 20:54051848-54051870 GCTACTCTGGAGGTTGAGGAAGG - Intronic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175331606 20:58168446-58168468 GCTGGTCTGCAGATACAGGATGG - Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175974163 20:62702057-62702079 GCTGCTCTGCACCTGGAGGTGGG - Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1177292177 21:19127953-19127975 GCTCTTCAGAAGAGGGAGGAGGG + Intergenic
1177890499 21:26798652-26798674 GCTGCTTTGAAAATGGAGGAAGG - Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179667553 21:42923123-42923145 GGTCCTCTGCAGAGGGGGCACGG + Intergenic
1180552642 22:16553006-16553028 GCTCCTCTGTAGGTTGAGGCAGG - Intergenic
1181351388 22:22261030-22261052 GCTCCTCTGTAGGTTGAGGCAGG + Intergenic
1181638588 22:24185474-24185496 GCTGCTCTGCAGACGGACTACGG + Exonic
1182027551 22:27132363-27132385 GCTGCTCAGCAGATGGAAGCAGG + Intergenic
1182592152 22:31389635-31389657 GCTACTCAGCAGATTGAGGTGGG - Intergenic
1182772533 22:32805538-32805560 GCTGCTATCCAGCTGGAGGAGGG + Intronic
1183560298 22:38567741-38567763 GCTTCTCTAGAGATTGAGGAAGG + Intronic
1183852378 22:40601325-40601347 GCTCCTCTGAAGGCGGAGGCAGG - Intronic
1184066305 22:42123749-42123771 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184068773 22:42135901-42135923 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
1184935392 22:47716851-47716873 GCCCGTGTGCAGAAGGAGGAAGG + Intergenic
1185014002 22:48333092-48333114 GCTCCACTGCATCTGGAGAAGGG + Intergenic
1185183187 22:49375479-49375501 GCTACTCTGCAGACTGAGGTGGG - Intergenic
1185290143 22:50020349-50020371 GCACGTCATCAGATGGAGGAGGG - Intronic
1185349230 22:50326023-50326045 GCCCACCTGCAGATGGAGGGAGG - Intronic
949516682 3:4813881-4813903 GACCCTCTGCAGCTGGAGAAAGG + Intronic
952359706 3:32617633-32617655 GCTACTCGGGAGATGGAGGCAGG + Intergenic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954271632 3:49514580-49514602 GCTACTCGGGAGATGGAGGCAGG - Intronic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
955817256 3:62858345-62858367 GCTCCTCTCCTGATGGACTATGG - Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
957346817 3:78971875-78971897 GCTGCTCTGGAGATTGAGGCAGG - Intronic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
958472290 3:94535950-94535972 GCACCCCTGCAGGTGGAAGAGGG - Intergenic
959902375 3:111674973-111674995 TCCCCTCTGGAGATGGGGGAAGG - Exonic
960085904 3:113591103-113591125 TATACTTTGCAGATGGAGGAAGG + Intronic
960700110 3:120431081-120431103 GGTACTCAGCAGATTGAGGAAGG - Intronic
961184857 3:124905871-124905893 GCTCCTTTGCTGATGGAGGAGGG + Exonic
961273310 3:125706615-125706637 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
961474358 3:127137441-127137463 GCTCCTCTGCTTCTGCAGGACGG + Intergenic
963254542 3:143131706-143131728 GCTGGTCTGCAGATTGAGTATGG + Intergenic
963555862 3:146787544-146787566 GCACCTCTGGAAATGGAGAAAGG - Intergenic
965461954 3:168976825-168976847 GCTACTCAGGAGATGGAGGCAGG + Intergenic
965956622 3:174377895-174377917 GCATCTCTGCGGATGGTGGAGGG - Intergenic
966175111 3:177130031-177130053 GCTACTCAGGAGATGGAGGCTGG + Intronic
966302488 3:178495107-178495129 GCTCCTGGGCACCTGGAGGATGG - Intronic
966542012 3:181102568-181102590 GCTGCTCAGGAGATGGAGGTGGG - Intergenic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967594469 3:191313840-191313862 GCTACTCAGGAGGTGGAGGAAGG - Intronic
968090899 3:195897611-195897633 GCTACTCAGGAGATGGAGGCAGG - Intronic
969354979 4:6620004-6620026 GCACCGCTGGAGCTGGAGGACGG + Exonic
969613389 4:8238979-8239001 GCACCTCTACACAAGGAGGAGGG - Intronic
969735258 4:8984680-8984702 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
972032978 4:34485960-34485982 GCTACTCAGCAGGTTGAGGAGGG - Intergenic
973247384 4:48024082-48024104 GCTACTCTGGAGGTGGAGGCAGG - Intronic
973907569 4:55546689-55546711 GCTCCTGGGCTGGTGGAGGAGGG - Intronic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
975812938 4:78188431-78188453 GCTCATCTGATGATGGAGGCTGG + Intronic
976163889 4:82232726-82232748 GCTACTCAGGAGATTGAGGAGGG + Intergenic
976300047 4:83508367-83508389 GGTCCTCTGCAGAGGGGGCACGG + Intronic
977434077 4:96971176-96971198 GCTACTCTGCAGGTTGAGGCAGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
981509003 4:145534305-145534327 GCCCTTCTGAAGATGTAGGAAGG - Intronic
981578373 4:146228265-146228287 CCTCCTCTGCAGCTCCAGGAAGG - Exonic
983107217 4:163702275-163702297 GCTCCACTGGTGATGGAGGGAGG + Intronic
983766064 4:171486245-171486267 TTGCCTCTGCTGATGGAGGATGG + Intergenic
983772486 4:171569358-171569380 GATCCTCACCACATGGAGGATGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985768481 5:1794649-1794671 GCTCCTCCTCACATGGTGGATGG + Intergenic
985847136 5:2358692-2358714 GCTCCTCGGGAGGTGGAGGTTGG + Intergenic
985871066 5:2557030-2557052 GCTCCTCTCCTGGTGGATGAAGG + Intergenic
986116683 5:4782253-4782275 GCTCCTGGGTAAATGGAGGAAGG - Intergenic
986143708 5:5056579-5056601 GTGCCTCTGCTGATGGAGGCTGG + Intergenic
988288357 5:29251322-29251344 GGTCCTTTGGTGATGGAGGATGG - Intergenic
989299220 5:39869128-39869150 GTACCACTGCACATGGAGGAGGG - Intergenic
989585813 5:43073171-43073193 GGTCCTCTGCAGAGGGGGCATGG + Intronic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
990739734 5:58900188-58900210 TCTCCCATGCAGCTGGAGGATGG - Intergenic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
992591819 5:78303440-78303462 GCTGCCCTGGAGATGGAGGAAGG - Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995376363 5:111478987-111479009 GCTACTCAGGAGATGGAGGTGGG - Intronic
995677428 5:114678224-114678246 GCTCATCTGCATATGTAGAAGGG + Intergenic
996324533 5:122258209-122258231 GCTCCTGTCCTGATGGGGGATGG + Intergenic
997100720 5:130966066-130966088 GCTACTCTGGAGGTGGAGGCAGG - Intergenic
997142252 5:131394976-131394998 GCTCTTTTGGAGATGGAGGTGGG + Intronic
998342373 5:141429459-141429481 GCTACTCTGGAGATTGAGGTGGG - Intronic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999198128 5:149796749-149796771 GCTCCTCAGCAGCTGGGTGAAGG + Intronic
999458427 5:151737173-151737195 GCTGCTGTGCAGGTGAAGGAAGG + Intergenic
1000334880 5:160234820-160234842 GCCACTGTGCAGATGGAGGGCGG + Exonic
1001257451 5:170194905-170194927 GCTACTCAGGAGATGGAGGCAGG + Intergenic
1001316953 5:170650031-170650053 GCTCCTGTGCAGTTGGGAGAAGG + Intronic
1001696363 5:173673338-173673360 ACTCCTATGCAACTGGAGGAAGG - Intergenic
1001848010 5:174938584-174938606 GCACAGCTGCACATGGAGGAAGG - Intergenic
1003009968 6:2417423-2417445 GCTCCTCTGCCCCTGGAAGATGG - Intergenic
1003015144 6:2462177-2462199 GCACCTCTGCAGACGGGGGGTGG + Intergenic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1003626659 6:7747411-7747433 GCACCTTTGAAGATGGAGGAAGG + Intronic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1006469664 6:34221255-34221277 GCTCCTCGGGAGACTGAGGAAGG - Intergenic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1006880969 6:37339386-37339408 GCTACTCTGGAGATTGAGGCAGG + Intergenic
1007076045 6:39066803-39066825 ACTCCTCTGCACTTGGAGAAGGG + Intronic
1007230393 6:40343993-40344015 GCTCCCCTGCAGATAGTTGAAGG - Intergenic
1009762991 6:68032065-68032087 GCTACTCGGGAGATGGAGGCAGG + Intergenic
1010255035 6:73747979-73748001 GCTACTCGGGAGATGGAGGCAGG - Intronic
1011559206 6:88598133-88598155 GCTCCGCTGAGGATGGAGGAAGG + Intergenic
1011792217 6:90910796-90910818 GTTCCTCAGCAGATGGAGGTCGG - Intergenic
1013315198 6:108935551-108935573 GCTACTCTGCAGGTTGAGGCAGG - Intronic
1013348147 6:109282156-109282178 GCACCTAGGCAGATGGAGGTGGG - Intergenic
1015119887 6:129689402-129689424 GCTACTCTGGAGGTGGAGGCAGG - Intronic
1015277747 6:131402273-131402295 GCTCATATGCATATGGAGGTGGG + Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1016282268 6:142431809-142431831 GCTACTCAGCAGATTGAGGCAGG + Intronic
1017428744 6:154349301-154349323 GCTACTCAGGAGATGGAGGCAGG - Intronic
1017937041 6:159014938-159014960 GCTACTCTGCTGATTGAGGTTGG - Intergenic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019582740 7:1774803-1774825 GCTACTCTGCAGACTGAGGCAGG + Intergenic
1019608021 7:1919805-1919827 GCTCCTGAGCTGATGGAGGAGGG - Intronic
1019898488 7:4001187-4001209 GCCCCTCTCCAGATGGAAGCTGG - Intronic
1019908934 7:4086559-4086581 GCTGCTCTGAAGATGAAGGAAGG - Intronic
1019990809 7:4689335-4689357 GCCTCTCAGCAGATGGAGCATGG - Intronic
1021473529 7:21034050-21034072 GCTCCTCTGAAGACTGAGGCAGG + Intergenic
1022184532 7:27954348-27954370 GTTCCTCTGCAGATGACGGCAGG - Intronic
1022514680 7:30967985-30968007 GCTGGTCTGAAGATGGAGAAAGG - Intronic
1023112049 7:36823788-36823810 GCTACTCGGGAGATTGAGGAAGG + Intergenic
1023895779 7:44431782-44431804 GCTACTCTGGAGATTGAGGCAGG - Intronic
1024082187 7:45864847-45864869 GATCCTCTGCAGTTGGATGTTGG - Intergenic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1024956566 7:54926993-54927015 GCTCCTCTGCCTATGGAAAAGGG + Intergenic
1026148808 7:67771149-67771171 GCTCCTTTGGAGGTTGAGGAGGG - Intergenic
1026154224 7:67813191-67813213 GCTACTCTGGAGACCGAGGAGGG - Intergenic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026575988 7:71571898-71571920 GCTCCTCTGGAGACTGAGGTAGG + Intronic
1026655588 7:72253850-72253872 GCTCCTCTGGAGGCGGAGGCAGG - Intronic
1026812886 7:73483751-73483773 GCTACTTTGGAGATGGAGGCAGG - Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1027793781 7:82666198-82666220 TCTGCTCTGATGATGGAGGATGG - Intergenic
1028597419 7:92560116-92560138 GCTACTCGGGAGATGGAGGTGGG + Intergenic
1028929679 7:96398478-96398500 GCTGCTCAGGGGATGGAGGAGGG + Intergenic
1029572930 7:101382928-101382950 GCTACTCTGGAGGTGGAGGCAGG + Intronic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1030871787 7:114764786-114764808 GCTACTCTGGAGGTGGAGGTGGG + Intergenic
1031170353 7:118285519-118285541 GCTACTCAGGAGATGGAGGTGGG + Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032415990 7:131736050-131736072 GCACCTCTGCAGAGAGATGATGG + Intergenic
1032544874 7:132733658-132733680 GCTACTCTGGAGACTGAGGATGG + Intergenic
1033964468 7:146958249-146958271 GAACCTATCCAGATGGAGGAAGG + Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1035407716 7:158610549-158610571 GCTACTCTGGAGATTGAGGCAGG - Intergenic
1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG + Intergenic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1036286085 8:7445184-7445206 GCTTCTCTGCAGAGTGAGGGAGG + Intronic
1036335389 8:7866345-7866367 GCTTCTCTGCAGAGTGAGGGAGG - Intronic
1036708612 8:11062963-11062985 GAGCCCCTGGAGATGGAGGATGG + Intronic
1036710650 8:11076452-11076474 GCTCCTCTGCTGATGGGGTAAGG - Intronic
1036819222 8:11926264-11926286 GCTGCTCAGGAGATGGAGGCAGG + Intergenic
1037581351 8:20247620-20247642 GCTCCTCTGTCGTTTGAGGATGG + Exonic
1037830876 8:22188278-22188300 GCTACTCAGGAGATGGAGGTGGG - Intronic
1038954833 8:32456492-32456514 GGTCATCTTCAGATGGAGTAGGG - Intronic
1039738621 8:40359120-40359142 TCTCCTCTGGAGCTGGAGAAAGG + Intergenic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1041766280 8:61421445-61421467 GCTACCCTGTAGGTGGAGGATGG - Intronic
1042020412 8:64368424-64368446 TCCCCTCTGGAGATGGAGCAAGG - Intergenic
1042967390 8:74369485-74369507 GCTTCACAGCAGATGGAAGATGG + Intronic
1043481777 8:80660358-80660380 GCTACTTTGGAGATGGAGGCAGG + Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1048992659 8:139770377-139770399 GCTCCTTTGCAGAGCGGGGAAGG + Intronic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049843739 8:144789892-144789914 GCATCTCTGCGGATGGTGGAGGG + Exonic
1049884731 9:19351-19373 GCTGCTCTGCACGTGGAGTATGG - Intergenic
1050992615 9:12172477-12172499 GCTCCTCTGCAGAGGTGGTAAGG + Intergenic
1051432864 9:16998428-16998450 GCTGCTCTAAAGATGGAGGCAGG + Intergenic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1052929194 9:34042364-34042386 GCTACTCGGGAGATGGAGGCTGG + Intronic
1052946617 9:34173546-34173568 GCTACTCTGGAGATGGAGGTGGG + Intergenic
1053011146 9:34634354-34634376 GCTACTCTGGAGACTGAGGAAGG + Intergenic
1053510335 9:38682416-38682438 GCTTTGCTGCAGATGGAAGAAGG + Intergenic
1054809268 9:69421959-69421981 GCTTCTCCCCAGCTGGAGGAAGG + Intergenic
1055938712 9:81628156-81628178 GCTACTCTGCAAATGGCGGTGGG + Intronic
1056863648 9:90210503-90210525 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
1056916262 9:90748944-90748966 GCTGCTCGGGAGATGGAGGCAGG + Intergenic
1059552016 9:115238494-115238516 GCTCTTATGCATATGGAGAAAGG + Intronic
1059828140 9:118057118-118057140 GCTACTCAGGAGATGGAGGCTGG - Intergenic
1059990176 9:119857976-119857998 GCTGCTTTGAAGATGAAGGAAGG - Intergenic
1060035789 9:120254516-120254538 GCTCCTCTGTAGGTTGAGGCTGG - Intergenic
1060892098 9:127195451-127195473 GCTCAGCAGCTGATGGAGGAAGG + Intronic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1203790254 EBV:147695-147717 GCTCCTGTGCCGCTGGATGAGGG + Intergenic
1203489576 Un_GL000224v1:90662-90684 GGTACTCTGCAGATGCAGGTGGG - Intergenic
1203502198 Un_KI270741v1:32550-32572 GGTACTCTGCAGATGCAGGTGGG - Intergenic
1185526647 X:785488-785510 GCTACTCGGGAGACGGAGGAAGG - Intergenic
1185532830 X:835327-835349 GCTCCTCTGCAGGTTGAGGCAGG - Intergenic
1185881253 X:3743202-3743224 GCTACTCGGGAGATGGAGGTGGG + Intergenic
1186331202 X:8536059-8536081 GCTCTTTTGAAGATGGAGGCAGG + Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1188990038 X:36807175-36807197 GCTGCTTTGGAGATGCAGGAAGG - Intergenic
1189665841 X:43354114-43354136 GCTACTCGGCAGATTGAGGCAGG - Intergenic
1189824116 X:44899390-44899412 GCTCCACTGAAACTGGAGGAGGG + Intronic
1190261214 X:48798511-48798533 CCTCCTCTGCAGATAGATGTGGG + Intergenic
1190632935 X:52406085-52406107 GCACCTCTTCAAATGGAGGCAGG + Intergenic
1192268101 X:69554308-69554330 GCTGCTTTGAAAATGGAGGAAGG + Intergenic
1192580781 X:72279132-72279154 GCTCCTCTGCAGACTGCTGAGGG - Intronic
1194476938 X:94369750-94369772 GCTCCTCTGCCTTTGGAAGAAGG + Intergenic
1195501224 X:105602033-105602055 GCAGCTCTGCGGCTGGAGGAGGG - Intronic
1196304703 X:114087440-114087462 GCTCCTCTGCATGTGGAAGGTGG + Intergenic
1198737925 X:139807838-139807860 GCTACTCTGGAGATGGAGGTGGG + Intronic
1199645807 X:149909633-149909655 GCTCCTCTGCCTATGGAAAAGGG + Intergenic
1200966283 Y:9041817-9041839 GATCCTCAGCAGTTAGAGGAAGG - Intergenic
1202147144 Y:21810348-21810370 GATCCTCAGCAGTTAGAGGAAGG + Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic