ID: 1186430715

View in Genome Browser
Species Human (GRCh38)
Location X:9502012-9502034
Sequence CCACAGCCACATGTGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186430715_1186430718 -7 Left 1186430715 X:9502012-9502034 CCATGCGCCACATGTGGCTGTGG 0: 1
1: 0
2: 3
3: 46
4: 298
Right 1186430718 X:9502028-9502050 GCTGTGGAGTGCTTGAAATGTGG 0: 1
1: 2
2: 39
3: 194
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186430715 Original CRISPR CCACAGCCACATGTGGCGCA TGG (reversed) Intronic
900031068 1:373604-373626 ACACAGCCACATGTGGGACAGGG + Intergenic
900051639 1:601858-601880 ACACAGCCACATGTGGGACAGGG + Intergenic
900072456 1:782415-782437 CAACAGCCACATGTGGCAAGTGG + Intergenic
900298375 1:1964328-1964350 CCACTGCCCCAAGTGGCACAGGG + Intronic
900333741 1:2150438-2150460 CCACAGGGACATGTGGCCCAGGG - Intronic
901065057 1:6490507-6490529 CCAAAGCCTCATGGGGCGCGCGG + Intronic
901171903 1:7265184-7265206 TCACCACCACATGTGGCTCATGG - Intronic
901200021 1:7461423-7461445 CAACAGCCACATGTGGCCGAGGG - Intronic
901728461 1:11261116-11261138 CCACAGCCACATGTGGCTGGTGG + Intronic
903135223 1:21305064-21305086 AAATAGCCACATGTGGCTCATGG - Intronic
903630642 1:24767131-24767153 CCTGGGCCACATGTGGCCCACGG + Intronic
905298305 1:36968691-36968713 CCACAGCTCCACGTGGGGCAAGG + Intronic
905806226 1:40879703-40879725 CAGTAGCCACATGTGGCTCATGG + Intergenic
907447553 1:54518510-54518532 CAACAGCTACATGTGGCTCATGG - Intergenic
907692442 1:56682799-56682821 ACACAGCCACATGTGGCCACTGG - Intronic
907745906 1:57213387-57213409 CAACAGCCACATGTCACTCACGG + Intronic
907755757 1:57308970-57308992 TGACAGCCACATGTAGCCCAGGG + Intronic
909582724 1:77256172-77256194 CCTGGGCCACATGTGGCCCATGG - Intergenic
910275823 1:85448054-85448076 CCTAGGCCACATGTGGCCCATGG - Intronic
911108195 1:94154445-94154467 CCATAGCCACATGTGGCTGGTGG - Intronic
911143919 1:94534542-94534564 CAACAGCCACATGTGGCTAGTGG + Intronic
912399668 1:109379385-109379407 CCTGGGCCACATGTGGCCCACGG + Intronic
913204097 1:116519825-116519847 CCATAGCCACATGTAGCTCATGG + Intronic
913679787 1:121178856-121178878 CAACAGCCACATGTGGCTAGTGG - Intronic
914031622 1:143966506-143966528 CAACAGCCACATGTGGCTAGTGG - Intronic
914157823 1:145101459-145101481 CAACAGCCACATGTGGCTAGTGG + Intronic
914912403 1:151798227-151798249 CAATAGCCACATGTGGCCAATGG - Intergenic
916853428 1:168726755-168726777 CCACTGCCTAATGTGGAGCATGG - Intronic
917339511 1:173960538-173960560 CAACAGCCACATGTGGCTAGTGG + Intronic
918433354 1:184485171-184485193 CAATAGCCACATGTGGCTCATGG - Intronic
918941008 1:190996749-190996771 CAATAGCCACATGTGGCTAATGG - Intergenic
919466102 1:197922688-197922710 TCTCAGCCACATGTGGGCCAGGG - Intronic
920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG + Intronic
920467097 1:206197392-206197414 CAACAGCCACATGTGGCTAGTGG - Intronic
921854663 1:219968852-219968874 CCACAGACACATTTGGCTCCAGG + Exonic
922267397 1:223996374-223996396 CAACAGCCACATGTGGCAAGTGG + Intergenic
922526443 1:226308492-226308514 CCACAGCCACCTGTGGTCCCAGG + Intronic
922863491 1:228839127-228839149 ACACAGCCACATGTCCCACAGGG - Intergenic
923940931 1:238825736-238825758 CAATAGCCACATGTGGCTCATGG - Intergenic
1064143600 10:12810233-12810255 CCACAGCCACATGGGACACCAGG - Intronic
1065198004 10:23285862-23285884 CAATAGCCACATGTGGCCAAGGG + Intronic
1065873597 10:29977868-29977890 CAACAGCCACATGTGGCCAGTGG + Intergenic
1068140689 10:53003067-53003089 CCTGAGCCACATGTGGCCCATGG + Intergenic
1069386922 10:67892061-67892083 CAACAGCCACATGTGGCTAGTGG - Intronic
1070787986 10:79173203-79173225 CCTGAGCCACGTGTGGCCCATGG - Intronic
1071529894 10:86381043-86381065 CTGCAGCCACAGGTGGCCCAAGG - Intergenic
1072936699 10:99719972-99719994 CCACAGGCACATGTGGCTAGGGG - Intronic
1075005542 10:118827376-118827398 CCAAGGCCACATGTGGCACTGGG + Intergenic
1075468428 10:122669975-122669997 CCACATGCACATGTGCCTCAGGG + Intergenic
1075864260 10:125704271-125704293 CCGCAGCCTCATGGGGCCCAGGG - Intergenic
1076186620 10:128455157-128455179 CCTGGGCCACATGTGGCCCATGG + Intergenic
1076700665 10:132271036-132271058 CCACAGTCAGATGGGGTGCAAGG + Intronic
1077252621 11:1567286-1567308 CCACAGCCACAGGAGGCACTGGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1078468083 11:11565153-11565175 CCACTGCCTCATCTGGAGCATGG + Intronic
1078506698 11:11955536-11955558 CAATAGCCACATGTGGCTAATGG + Intronic
1078833869 11:15006491-15006513 CAACAGCCACATGTGGCTAGCGG + Intronic
1079634695 11:22721668-22721690 CAATAGCCACATGTGGCTAATGG + Intronic
1080247007 11:30190586-30190608 CAATAGCTACATGTGGCTCATGG + Intergenic
1081041426 11:38219306-38219328 TGATAGCCACATGTGGCTCATGG + Intergenic
1081296467 11:41395959-41395981 CCTGGGCCACATGTGGCCCATGG - Intronic
1082283280 11:50294833-50294855 CAACAGCCACATGTGGCAAGTGG - Intergenic
1083209079 11:61171474-61171496 CCACAGCCTCGTCTGCCGCAGGG + Intergenic
1084424647 11:69077779-69077801 CCACAGCCACATGTGACACGTGG - Intronic
1085763892 11:79265355-79265377 CCATAGCCACATGTGGCCAATGG - Intronic
1087102889 11:94381875-94381897 CCAGAGCCTCCTGTGGGGCAGGG + Intronic
1087758206 11:102077157-102077179 CCACAGGTTCATGTGGCGGATGG - Intronic
1088698916 11:112394633-112394655 CCACAGGCACATCTGGCCCCAGG + Intergenic
1088889694 11:114034855-114034877 CTACAGCCACATGTAGGGGAAGG + Intergenic
1089437109 11:118478471-118478493 CAATAGCCACATGTGGCTAATGG - Intronic
1090215412 11:124958277-124958299 CCTGGGCCACATGTGGCCCATGG - Intronic
1090386414 11:126359893-126359915 CCACGGCCACACGTGGGGAAGGG + Intronic
1091285607 11:134407073-134407095 CAACAGCCACATGTGGCTAGAGG - Intronic
1092755449 12:11758940-11758962 GTACAGCCACATGTGCCGCGGGG - Intronic
1094013938 12:25841525-25841547 CAACAGCCACATGTGGCTAGTGG + Intergenic
1094021475 12:25918992-25919014 CAACAGCCACATGTGGCCAAGGG - Intergenic
1094120002 12:26962067-26962089 CAACAGCCACATGTGGCTACTGG - Intronic
1094284540 12:28778121-28778143 CAATAGCCACATGTGGCTAATGG + Intergenic
1096428656 12:51525145-51525167 CCATAGCCACATGTGGCTAATGG + Intergenic
1096547916 12:52353930-52353952 CCACTGCCTCCTGTGGCTCAGGG + Intergenic
1099205249 12:79719385-79719407 CCTGAGCCACATGTGGCCCATGG - Intergenic
1100395110 12:94179278-94179300 CATCAGCCACATTGGGCGCATGG - Intronic
1100605831 12:96151244-96151266 CAATAGCCACATGTGGCTAACGG - Intergenic
1101129152 12:101671121-101671143 CAACAGCCACATGTGGCTAGTGG - Intronic
1101572526 12:105967068-105967090 GCTCAGCCACATGTTACGCAGGG - Intergenic
1101805345 12:108058565-108058587 CAACAGCCACATGTGGCTACTGG - Intergenic
1101917911 12:108910510-108910532 CTACAGCCACACGTGGTTCAAGG + Intergenic
1103932415 12:124457739-124457761 AAACAGGAACATGTGGCGCAGGG + Intronic
1104091032 12:125517876-125517898 CACCAGCCACATGTGGCCCTTGG - Intronic
1106014417 13:25854746-25854768 CAATAGCCACATGTGGCTAATGG - Intronic
1109076350 13:57840958-57840980 AGATAGCCACATGTGGCACATGG - Intergenic
1110253441 13:73406036-73406058 CCTGGGCCACATGTGGCACACGG + Intergenic
1110333380 13:74298446-74298468 CCACAGCCACATGTGGCTAGCGG + Intergenic
1115178872 14:30598852-30598874 CAACAGCCACATGTGGCTAGTGG - Intronic
1115481093 14:33861907-33861929 CAACAGCCACATGTGGCTAGTGG - Intergenic
1116850520 14:49904254-49904276 CCATAGCCACATGTGGCTAGTGG + Intergenic
1117235880 14:53774078-53774100 CCTGGGCCACATGTGGCCCATGG - Intergenic
1117618438 14:57558951-57558973 CAATAGCCACATGTGGCTAATGG + Intergenic
1119151980 14:72369124-72369146 CCTGAGCCACATGTGGCCCATGG + Intronic
1119398135 14:74343671-74343693 CCACAGCCACATGTGGCTGGTGG - Intronic
1119420345 14:74504484-74504506 CCACAGCCACATGTGGGCACAGG - Intronic
1119435136 14:74593680-74593702 CGATACCCACATGTGGCTCAGGG + Intronic
1120979379 14:90277123-90277145 CTACAGCCACCTGTAGCTCAGGG + Exonic
1121505650 14:94474658-94474680 CCACAGCCAAAAGAGGGGCAAGG - Intronic
1122641878 14:103164852-103164874 CCACAGGCACGTGTGGCACATGG + Intergenic
1122960741 14:105092740-105092762 CCTCTGCCACATATGGCCCAGGG + Intergenic
1124011367 15:25842046-25842068 CAACAGCAACAGGTGGCCCAGGG - Intronic
1125076149 15:35620735-35620757 CCACAGCTACATGTGGCTAGTGG - Intergenic
1126509555 15:49453525-49453547 CAGTAGCCACATGTGGCACATGG + Intronic
1126695302 15:51320984-51321006 CGACAGCCACCTGTGGCTCACGG + Intronic
1128226667 15:66006482-66006504 GCTCAGCCACATGTGGAGAATGG - Intronic
1128741136 15:70084435-70084457 CATCAGCCACATGTGGATCAGGG - Intronic
1129928345 15:79385694-79385716 CCACAGCCACAGTTTGGGCAGGG + Intronic
1130352240 15:83102951-83102973 CAACAGCCACATGTGGCTAGTGG - Intergenic
1131573803 15:93566369-93566391 CAACAGCCACTTGTCGCCCATGG - Intergenic
1131715801 15:95109800-95109822 CAACAGCCACATGTGGCTAGAGG + Intergenic
1132080239 15:98857646-98857668 CCATAGCCACATGTGGCTAGCGG - Intronic
1133155215 16:3869655-3869677 CAACAGCCACACGTGGCTCGTGG + Intronic
1133222289 16:4323947-4323969 CCACAGCCAGGGGTGGCACAGGG + Intronic
1133349703 16:5093331-5093353 CTGCAGCCACATGTGACCCATGG - Intronic
1133712716 16:8416929-8416951 CAAAAGCCACATGTGGCCAATGG + Intergenic
1135171462 16:20187772-20187794 CAACAGCCACATGTGGCTAGTGG + Intergenic
1136591599 16:31221114-31221136 CCCCACCCACATGTGTCTCACGG - Intronic
1137625421 16:49904874-49904896 CAACAGCCACATGTGGCCAGCGG + Intergenic
1137725377 16:50653366-50653388 CCACATCTACATGTGGAGAAAGG + Intergenic
1139830684 16:69795443-69795465 CAATAGCCACATGTGTCTCATGG + Intronic
1140533583 16:75688911-75688933 CCACAGCCACATGAGTGGCTGGG + Intronic
1141944044 16:87297653-87297675 CTCCAGCCACATGTGGTTCATGG + Intronic
1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG + Intronic
1142268033 16:89073693-89073715 CCACACCCACGTGTGGCACTTGG + Intergenic
1142307748 16:89295105-89295127 CCACAGACAGATGTGGCCCTGGG + Intronic
1142336843 16:89494903-89494925 CATCAGCCACATGTGGCTCCAGG + Intronic
1142595133 17:1026298-1026320 CCTCAGGCTCATGTGGCACAAGG - Intronic
1142599778 17:1047971-1047993 CCACAGCCACCAGTGGCCCAGGG + Intronic
1143510437 17:7392810-7392832 CCACAGCCACAGGTCCAGCAGGG + Exonic
1143712582 17:8744666-8744688 GCAGAGCCACAGGTGGCTCAGGG + Exonic
1145833605 17:27937219-27937241 CACCAGGCACATGTGGGGCAAGG - Intergenic
1146648778 17:34593415-34593437 CCACAGCCACATGTGGTGAGTGG + Intronic
1147048523 17:37772930-37772952 CCCAGGCCACATGTGGCCCATGG + Intergenic
1150099352 17:62408627-62408649 CAACAGCCATATGTGGCTAATGG + Intronic
1150114329 17:62532055-62532077 CCAAAGCCACATATGGCCTAAGG - Intronic
1151388401 17:73769596-73769618 CAATAGCCACATGTGGCTCAGGG + Intergenic
1152860908 17:82696907-82696929 CCACAGCCACACGTGGCTCATGG + Intronic
1152948572 17:83212065-83212087 ACACAGCCACATGTGGGACAGGG - Intergenic
1153361753 18:4205726-4205748 CAATAGCCACATGTGACTCATGG + Intronic
1156336376 18:36176196-36176218 TCATAGCCACATGTGGCTCATGG + Intronic
1156803614 18:41149138-41149160 CCTGGGCCACATGTGGCCCATGG + Intergenic
1157016901 18:43726014-43726036 CAATAGCCACATGTGCCTCATGG + Intergenic
1157141011 18:45106518-45106540 CCACAGCCACATGTGACTTGTGG - Intergenic
1157625855 18:49050568-49050590 CCGCAGCCCCGTGTGGCTCAGGG - Intronic
1158705981 18:59792466-59792488 CCTCAGCCACATGGGGAGCTAGG + Intergenic
1159608970 18:70505339-70505361 CAAAACCCACATGTGGCTCATGG - Intergenic
1159864464 18:73687949-73687971 CCAAATCCACATGGGGCGTATGG - Intergenic
1161066833 19:2242806-2242828 CCACATCTGCTTGTGGCGCAGGG - Intronic
1163156208 19:15440984-15441006 CCACATCCCCGTGTGGCCCAGGG - Intronic
1163686640 19:18715620-18715642 CCTCAGCCACCTGTGGCCCCGGG + Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165367892 19:35380733-35380755 CCACAGCCCCATGTGGTGACAGG - Intergenic
1167251872 19:48403362-48403384 CAACAGCCACATGTGGCTTGTGG - Intronic
1168310329 19:55456717-55456739 CCACATCCACACGTGGCTCCGGG + Intronic
926107837 2:10163398-10163420 CCACACCCACATGTGGAGCTTGG - Intronic
926298075 2:11582595-11582617 CCGCAGCCACATGTGGCCATCGG + Intronic
927498148 2:23564302-23564324 CCACAGCCACATGAGAGGAAGGG + Intronic
927699070 2:25256558-25256580 CCCCAGCCACATGTGGCTCTTGG - Intronic
930114156 2:47704599-47704621 CAACAGCCACATGTGGTGAGTGG - Intronic
930870512 2:56166334-56166356 CCTCAGCTGCATGTGGCCCATGG + Intergenic
931174683 2:59841826-59841848 CAACAGCCACATGTGGCTAGGGG + Intergenic
931518396 2:63068796-63068818 CAAAAGCCACATGTGGCTAATGG - Intergenic
932426320 2:71637635-71637657 CCACAACCAAATGTGGCTGAAGG - Intronic
933527430 2:83460333-83460355 CAATAGCCACATGTAGCTCACGG + Intergenic
933698879 2:85240159-85240181 CCATAGCCACATGTGGCAAGTGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936480667 2:112882236-112882258 CAACAGCCACATGTGGCAAGTGG + Intergenic
940351809 2:152699186-152699208 CCTGGGCCACATGTGGCCCATGG - Intronic
944071829 2:195679039-195679061 CAACAGCCACATGTAGCAAATGG - Intronic
944247120 2:197542930-197542952 ACACAGCTACATGGGGCTCATGG - Intronic
944416753 2:199486782-199486804 CCAGAGCCACATGTGGCTGGGGG + Intergenic
944491058 2:200258265-200258287 CCACAGCCTCCCGTGGCCCAGGG - Intergenic
944508097 2:200436054-200436076 CAACAGCCACATGTGGCCAGTGG + Intronic
944682954 2:202093396-202093418 CAATAGCCACATGTGGCTAATGG - Intronic
944911651 2:204316164-204316186 CCACAGCCTTTTGTGGCGGAAGG + Intergenic
944962739 2:204893767-204893789 CAACAGCCACATGTGGCTAGTGG + Intronic
946903275 2:224392979-224393001 CAGTAGCCACATGTGGCGAATGG + Intronic
947981764 2:234416558-234416580 TGACAGCCACATGTGGGACACGG - Intergenic
948996749 2:241584511-241584533 CCACACCCACTTCTGCCGCAGGG + Exonic
1168821167 20:774697-774719 TCACAGCCACATGTAGCAGAAGG + Intergenic
1169268930 20:4184345-4184367 CAACAGCCACATGTGGCTAGAGG + Intronic
1169651728 20:7876240-7876262 CAATAGCCACATGTGGCTGATGG + Intergenic
1169698104 20:8414710-8414732 CCACAGCTACATGTGGCTAATGG - Intronic
1170556285 20:17517822-17517844 CCACAGCCACATGCGGCTGGTGG + Intronic
1171344095 20:24452629-24452651 CCAGAGCCACAGGTGGCACCGGG + Intergenic
1172627921 20:36359055-36359077 CAATAGCCACATGTGGCTCATGG - Intronic
1172757435 20:37296159-37296181 CAACAGCCACATGTGGCTGGTGG + Intronic
1173730321 20:45323971-45323993 CAACAGCCACATGTGGCTAGTGG - Intergenic
1174054375 20:47787950-47787972 GACCAGCCACATGTGGCTCAGGG + Intergenic
1174085422 20:48004604-48004626 TCTCAGCCACATGTGGCACTGGG + Intergenic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1175207809 20:57325393-57325415 CCACAGCTCCACGTGGCACATGG - Intergenic
1175519489 20:59590953-59590975 CAACAGCCACATATGGGACATGG - Intronic
1175808856 20:61846690-61846712 CCACATCTAGATGTGGGGCAGGG + Intronic
1178752608 21:35318816-35318838 TCATAGCCACATGTGGCTCTTGG + Intronic
1178858170 21:36267440-36267462 CAACAGCCACCTGTGGCTAACGG - Intronic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1180642213 22:17308007-17308029 CCACAGCTGCATGTGGGGAAAGG + Intergenic
1180860761 22:19080494-19080516 AAACAGCCACATGTGACTCATGG + Intronic
1181734677 22:24872392-24872414 CAAGAGCCACATGTAGCCCATGG - Intronic
1182668460 22:31975867-31975889 CAAAAGCCACATGTGGTTCATGG - Intergenic
1182712554 22:32331931-32331953 CCAAAGCCACATCTGCCCCAAGG + Intergenic
950505225 3:13390474-13390496 GCACTGCCACATGTGGGACAGGG - Intronic
951126704 3:18993338-18993360 CAATAGCCACATGTGGCTAATGG - Intergenic
951648012 3:24915461-24915483 CAATAGCCACATGTGGCTAATGG + Intergenic
952205129 3:31173544-31173566 CAACAGCCACATGTGGTGAATGG - Intergenic
953236148 3:41109397-41109419 CAATAGCCACATGTGCCTCATGG + Intergenic
953348666 3:42197888-42197910 GCACAGCCACATGTGGCCAGTGG - Intronic
953525470 3:43686726-43686748 CCACAACCACATGTAGCTAATGG + Intronic
954063749 3:48089404-48089426 CACCAGCCACATGCGGCTCACGG - Intergenic
955102454 3:55863895-55863917 CAATAGCCACATATGGCTCATGG + Intronic
955112751 3:55965293-55965315 CAATAGTCACATGTGGCTCATGG - Intronic
955123838 3:56089642-56089664 CAATAGCCATATGTGGCTCATGG + Intronic
955650233 3:61186358-61186380 CCAGAGTCACCTGTGGCCCAGGG - Intronic
955809114 3:62767994-62768016 CAACAGCCACATGTGGCTAGTGG + Intronic
956068487 3:65422157-65422179 CCATAGCCACATGTGGCGAGTGG - Intronic
957707089 3:83802953-83802975 CCAAAGCCAAATCTGGAGCAAGG - Intergenic
958594075 3:96199898-96199920 CCTGAACCACATGTGGCCCATGG + Intergenic
958962638 3:100524544-100524566 CAATAGCCACATGTGGCTCGTGG - Intronic
961944775 3:130674277-130674299 CAAAAGCCTCATGTGGCTCATGG + Intronic
963506823 3:146196651-146196673 CCACAGCCATAGGTTGAGCATGG + Exonic
963547251 3:146675570-146675592 CAATAGCCACATGTGGCTAAGGG + Intergenic
963985209 3:151585097-151585119 CTACAGCCACATGTGGCTAGCGG - Intergenic
964683984 3:159374836-159374858 CTATAGCCACATGTGGCTAATGG - Intronic
965760629 3:172072160-172072182 CAACAGCCACATGTGACTAATGG - Intronic
968621492 4:1605300-1605322 CCCCAGCCACATGGGGAGGATGG - Intergenic
969598414 4:8161696-8161718 CCACACCCACACTTGGAGCACGG + Intergenic
970175094 4:13331502-13331524 CAACAGCCACATGTGGCTGGTGG + Intergenic
974358067 4:60837705-60837727 CAACAGCCACATGTGGCTAGTGG + Intergenic
976198620 4:82558293-82558315 CAATAGCCACATGTGGCTCATGG + Intronic
976862860 4:89687607-89687629 CAACTGCCACATGTGCCCCATGG + Intergenic
980161223 4:129165270-129165292 CCAAAGCCACATGTGGCCAGTGG - Intergenic
980436405 4:132780188-132780210 CAACAGCCACATGTGGCTAGTGG + Intergenic
980689889 4:136281505-136281527 CGCCAGGCACATGTGGGGCAAGG + Intergenic
981006018 4:139876028-139876050 CAACAGCCACATGTGGCTAGTGG - Intronic
982375969 4:154690977-154690999 CCATAGCCACATGTGGTGAGTGG - Intronic
984172856 4:176381520-176381542 CCATGGCCACATGAGGCCCAGGG + Intergenic
986450788 5:7862337-7862359 CAGTAGCCACATGTGGCTCATGG - Intronic
989467944 5:41779406-41779428 CAAAAGCCACATGTGGCTAATGG + Intronic
990536684 5:56730227-56730249 CCACAGCTACATCAGGTGCATGG + Intergenic
991449297 5:66734672-66734694 CAAAAGCCACATGTGGCTAATGG - Intronic
993548985 5:89250158-89250180 CCTGGGCCACATGTGGCCCACGG + Intergenic
994293867 5:98065289-98065311 CCAGTGCCACATGTGGCTAATGG - Intergenic
996471430 5:123865705-123865727 CGATAGCCACATGTGGCGAGTGG + Intergenic
996494524 5:124138535-124138557 GCACATCCACATGTGGCCCATGG - Intergenic
996833396 5:127764817-127764839 CCTGGGCCACATGTGGCCCACGG + Intergenic
997841673 5:137246761-137246783 CCACGGCCACATGTTGGGCAAGG - Intronic
998837918 5:146221381-146221403 CAAAAGCCACATGTGGCTAATGG - Intronic
998949823 5:147382048-147382070 CCTGAGGCACATGTGGCCCATGG + Intronic
999875859 5:155804974-155804996 CAAAAGCCACATGTGGCTAATGG - Intergenic
1000378284 5:160604817-160604839 CCATAGACACATGTGGCTCCTGG - Intronic
1001036406 5:168299895-168299917 CTCCAGCCACATGTGGTGCTAGG + Intronic
1001696676 5:173675413-173675435 CCCCAGGCACATGTGGCTCCTGG + Intergenic
1002297047 5:178237569-178237591 CCACAGCCAGAGGTGCCCCAGGG + Intergenic
1002742752 5:181445264-181445286 ACACAGCCACATGTGGGACAGGG - Intergenic
1003689156 6:8335850-8335872 CAATAGCCACATGTGGCTCGTGG + Intergenic
1003829814 6:9995424-9995446 CAATAGCCACATGTGGCTCATGG - Intronic
1004206310 6:13594624-13594646 GCTCAGCCACATGCTGCGCACGG - Intronic
1010205200 6:73316192-73316214 CAACAGCCACATGTGGCTAGTGG - Intergenic
1010439801 6:75880559-75880581 CCTGGGCCACATGTGGCCCATGG + Intronic
1010648605 6:78424392-78424414 CACCAGTCACATGTGGAGCAAGG + Intergenic
1011631693 6:89332543-89332565 CCATAGCCACATGTGGCTAATGG - Intronic
1011820380 6:91246224-91246246 CAATAGCCACATGTGGCTAATGG + Intergenic
1017264395 6:152425602-152425624 CAACAGCCGCCTGTGCCGCATGG - Intronic
1019247885 6:170721003-170721025 ACACAGCCACATGTGGGACAGGG - Intergenic
1019982302 7:4630427-4630449 CCAGAGCCACATCTTGCCCATGG + Intergenic
1020017323 7:4838564-4838586 CCACAGCCTCCTGAGGCCCAGGG + Intronic
1021852414 7:24821579-24821601 CCACACCCAGATGTGACTCATGG + Intronic
1021912878 7:25403956-25403978 CAATAGCCACATGTGGCTGATGG - Intergenic
1022118751 7:27286373-27286395 CCCGACCCACATGTGGCCCATGG - Intergenic
1022173219 7:27849299-27849321 CCACAGCCACCTGGGTGGCAGGG - Intronic
1023209003 7:37782829-37782851 CCACAGCACCATGTGGAGCATGG - Intronic
1023919916 7:44620665-44620687 CCTGGGCCACATGTGGCCCACGG - Intronic
1023991976 7:45133927-45133949 CCACAGGCCCATGAGGCCCACGG - Intergenic
1024068424 7:45765311-45765333 CAACAGCCACATGTGGCAAGTGG - Intergenic
1025628750 7:63247805-63247827 CAACAGCCACATGTGGCAAGTGG - Intergenic
1027434384 7:78149162-78149184 CCACAGCCACATGTGGCTAATGG + Intronic
1030586693 7:111429460-111429482 CCACACCCACATCTGGTGCTAGG + Intronic
1032044035 7:128587826-128587848 CCAAAGCCACATATGGCCTAAGG - Intergenic
1035500230 8:86861-86883 ACACAGCCACATGTGGGACAGGG + Intergenic
1035658539 8:1330112-1330134 CCACAGCCACACCTCTCGCAGGG - Intergenic
1035930564 8:3775879-3775901 GAGAAGCCACATGTGGCGCAAGG - Intronic
1036585072 8:10116181-10116203 CCTGGGCCACATGTGGCCCACGG - Intronic
1036607916 8:10324144-10324166 CAACAGCCACATGTGGCCAGAGG - Intronic
1037881010 8:22573522-22573544 CAACAGCCACAGGTGGCGAGTGG + Intronic
1039126946 8:34214473-34214495 CAACAGCCACATGTGGCTGTTGG + Intergenic
1041080543 8:54211072-54211094 CCACAGCCACATGTAGCTTTTGG - Intergenic
1042235195 8:66605257-66605279 CAATAGCCACATGTGGCTAATGG + Intronic
1042881484 8:73496853-73496875 CAATAGCCACATGTGGCTAATGG + Intronic
1043384868 8:79738287-79738309 CCATAGCCACATGTGGCTAGTGG + Intergenic
1043447564 8:80334101-80334123 CCTCGGCCACATGCGGCCCATGG - Intergenic
1043576181 8:81660204-81660226 CCTGAGCCACATGTGGCCCATGG + Intronic
1044522830 8:93219225-93219247 AAACAGCCACATGTGGCTAATGG - Intergenic
1044537459 8:93373881-93373903 GCACAGCCACATGTGGAGGTGGG + Intergenic
1044890651 8:96831949-96831971 CAATAGCCACATGTGGCTAATGG + Intronic
1045031174 8:98137714-98137736 CAACTGCCACATGTGGCTAATGG - Intronic
1045127639 8:99110527-99110549 CAACAGCCACATGTGGCTAGTGG - Intronic
1046752275 8:117938542-117938564 CCACAGTCCCATGTGGCTTATGG + Intronic
1047005621 8:120617024-120617046 CCCGGGCCACATGTGGCCCATGG - Intronic
1047781768 8:128117430-128117452 CCACTGGAACATGTGGCGAAAGG - Intergenic
1048951229 8:139498558-139498580 CCAAAACCAGATGTGGGGCATGG - Intergenic
1049098489 8:140562759-140562781 CCATAGCCACATGTGGCTAGTGG - Intronic
1049668250 8:143858404-143858426 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049668666 8:143860003-143860025 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669081 8:143861605-143861627 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669496 8:143863207-143863229 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049669906 8:143864800-143864822 CGACAGCCTCAGGTTGCGCACGG + Exonic
1049670323 8:143866408-143866430 CGACAGCCTCAGGTTGCGCACGG + Exonic
1050145767 9:2565759-2565781 CCACAGCCACGTATGGCGAAAGG + Intergenic
1050733769 9:8739491-8739513 ACACAGCCACATGTGGCTAGTGG + Intronic
1051813845 9:21081325-21081347 CACCAGCCACATGTGGTTCATGG + Intergenic
1052095214 9:24375362-24375384 CCTCAGCCACATGGGTCCCAGGG - Intergenic
1054841094 9:69741025-69741047 CAATAGCCACATGTGGCTAATGG + Intronic
1055027692 9:71739688-71739710 CCTGGGCCACATGTGGCCCACGG - Intronic
1055830663 9:80374777-80374799 CCTGGGCCACATGTGGCCCATGG - Intergenic
1056875716 9:90328533-90328555 TCACAGCCACCTGTGCCCCATGG + Intergenic
1057481414 9:95447973-95447995 CCACAGCCACGTGTGGCCGGTGG + Intronic
1057933737 9:99219300-99219322 CAACAGCCACATGTGGCTAGTGG + Intronic
1058196403 9:101982205-101982227 CCAAAGCCTAATGTGGAGCAAGG + Intergenic
1058449393 9:105081939-105081961 CCACAGCCAGATTTGGCCAATGG + Intergenic
1058622138 9:106894674-106894696 CAACAGCCACCTGTGGCTCAGGG - Intronic
1058797589 9:108513423-108513445 CCTGGGCCACATGTGGCCCATGG - Intergenic
1060157246 9:121328352-121328374 CAACAGCCACATGTGACTAATGG - Intronic
1060399085 9:123337284-123337306 CAACAGCCACATGTGGCCAGAGG - Intergenic
1061405082 9:130389167-130389189 GCACAGCCACGTTTAGCGCATGG - Intronic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1061837796 9:133341031-133341053 GCACAGACATATGTGGCTCAGGG + Exonic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1203608655 Un_KI270748v1:76482-76504 ACACAGCCACATGTGGGACAGGG - Intergenic
1186362771 X:8859899-8859921 CCACAGCCACATATGGCTAGTGG - Intergenic
1186430715 X:9502012-9502034 CCACAGCCACATGTGGCGCATGG - Intronic
1187531782 X:20103728-20103750 CAACAGCCACATGTGGCTAGTGG + Intronic
1188322355 X:28755352-28755374 ACACAGCCACATGTGGCTAGTGG - Intronic
1188680716 X:33000584-33000606 CCAAAGCCACATGTGGCTAGTGG - Intronic
1189027116 X:37407345-37407367 CCACAGTCACATGTCTCCCAAGG + Intronic
1190140558 X:47839846-47839868 CCGGAGCCACATGTGGCCCACGG - Intronic
1196112311 X:111960085-111960107 CAATAGCTACATGTGGCTCACGG + Intronic
1197128954 X:122981532-122981554 CCTGGGCCACATGTGGCCCATGG - Intergenic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1198672597 X:139097388-139097410 CCTGGGCCACATGTGGCTCATGG + Intronic
1202368518 Y:24182673-24182695 CCAGAGCCACGTGTGGCCAAGGG - Intergenic
1202502267 Y:25487444-25487466 CCAGAGCCACGTGTGGCCAAGGG + Intergenic