ID: 1186430859

View in Genome Browser
Species Human (GRCh38)
Location X:9503266-9503288
Sequence CTGTGGAAAAGCAGTTTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186430859_1186430861 -6 Left 1186430859 X:9503266-9503288 CCGGGGAAACTGCTTTTCCACAG 0: 1
1: 0
2: 4
3: 32
4: 290
Right 1186430861 X:9503283-9503305 CCACAGAACTGTGAAACCCACGG 0: 2
1: 31
2: 53
3: 124
4: 382
1186430859_1186430862 -1 Left 1186430859 X:9503266-9503288 CCGGGGAAACTGCTTTTCCACAG 0: 1
1: 0
2: 4
3: 32
4: 290
Right 1186430862 X:9503288-9503310 GAACTGTGAAACCCACGGATTGG 0: 1
1: 26
2: 67
3: 73
4: 117
1186430859_1186430865 30 Left 1186430859 X:9503266-9503288 CCGGGGAAACTGCTTTTCCACAG 0: 1
1: 0
2: 4
3: 32
4: 290
Right 1186430865 X:9503319-9503341 ACTCGTGAACCCACGCCACCAGG 0: 2
1: 11
2: 53
3: 197
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186430859 Original CRISPR CTGTGGAAAAGCAGTTTCCC CGG (reversed) Intronic
902511189 1:16967830-16967852 CTGTAGAAATGCAGATTCCAAGG - Intronic
905273276 1:36800982-36801004 CAGAGGAAAAGCAGATTCCATGG - Exonic
905751559 1:40469204-40469226 CTTTTGAAAAGCAGATTGCCTGG - Intergenic
911219083 1:95228247-95228269 CTGTTGCAAACCAGTTTCCCTGG + Intronic
912770645 1:112461621-112461643 CTGGGGAGGAGCAGATTCCCAGG + Intronic
913586418 1:120279306-120279328 CTGTGGGATAGCAGTTGGCCTGG + Intergenic
913621768 1:120619064-120619086 CTGTGGGATAGCAGTTGGCCTGG - Intergenic
914568426 1:148891168-148891190 CTGTGGGATAGCAGTTGGCCTGG + Intronic
914604399 1:149239083-149239105 CTGTGGGATAGCAGTTGGCCTGG - Intergenic
915114195 1:153585258-153585280 CTGGGAAAAGGCAGTCTCCCTGG - Intergenic
917024943 1:170631515-170631537 CGTGGAAAAAGCAGTTTCCCCGG + Intergenic
918566168 1:185935375-185935397 CTGTTAAAATGCAGATTCCCAGG - Intronic
918690471 1:187472945-187472967 CTTTGGAAAAACAGTTTCGGTGG + Intergenic
920083784 1:203398812-203398834 ATGTGGAAATCCAGTTTTCCTGG + Intergenic
920571462 1:207021221-207021243 CTGTGGAGAAGGACTCTCCCTGG + Exonic
922576959 1:226667272-226667294 CTCTGGGAAAGCAGTGTGCCAGG - Intronic
923031083 1:230249445-230249467 CTGTGGAAAAGAAATCTCCAAGG - Intronic
924945322 1:248842648-248842670 GTGTGGAGTAGAAGTTTCCCTGG - Intronic
1064564100 10:16622475-16622497 ATGTGGAAAAACAATTTCTCTGG + Intronic
1064744014 10:18461536-18461558 CTGTGGAAAAATAGTCTTCCAGG - Intronic
1066416930 10:35230307-35230329 CTGTGAACAAGTAGGTTCCCAGG - Intergenic
1066750657 10:38653095-38653117 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1066966388 10:42270018-42270040 CTGTGGTACTGCAGGTTCCCTGG + Intergenic
1067242809 10:44510524-44510546 CTGTGGAAATGAGGTTTGCCTGG + Intergenic
1068363904 10:56018652-56018674 CTGTGGAAATCCAGTTTTACAGG - Intergenic
1071163708 10:82780818-82780840 CTCTGGAAGAGCACTTTTCCTGG + Intronic
1075980325 10:126732847-126732869 CTCATGAAAAGCTGTTTCCCTGG - Intergenic
1078557624 11:12343027-12343049 CTTTGGGAAGGCAGATTCCCTGG + Intronic
1079095004 11:17504404-17504426 CTGAGAAACAGCAGTATCCCTGG - Intronic
1079935329 11:26609112-26609134 CGTGGAAAAAGCAGTTTCCCAGG + Intronic
1079962024 11:26936276-26936298 CAGTGGGAAAGCACTTTCCAGGG + Intergenic
1080301123 11:30785916-30785938 GTGTGAAAAAGCAGCTTCCTGGG - Intergenic
1080803853 11:35633955-35633977 CTGTGGAAAAGCAGATTCAGTGG + Intergenic
1081163317 11:39778353-39778375 TTGTGGTAAAGCAATTGCCCAGG + Intergenic
1082993795 11:59232726-59232748 CTTGGGTAAAGCAGTTTCCATGG - Intergenic
1086383457 11:86284088-86284110 CTGAGGAAAAGCAGCTTCCACGG + Intergenic
1087715245 11:101601341-101601363 GTATGGCAAAGCAGTTACCCTGG - Intronic
1088875625 11:113933793-113933815 ATGTGTCAAAACAGTTTCCCAGG - Intronic
1089950294 11:122519406-122519428 CTGGGTTCAAGCAGTTTCCCTGG - Intergenic
1090227965 11:125082948-125082970 CTATGGAAAAGCAGAGACCCAGG - Intronic
1090462364 11:126903117-126903139 CTGTGGTAAAGCACTCTCTCAGG + Intronic
1090944283 11:131415644-131415666 CTGTCAGAAAGCAGATTCCCAGG + Intronic
1091618002 12:2064533-2064555 GAGGGGAAAAGCAGCTTCCCAGG + Intronic
1091664944 12:2412132-2412154 CTCAGGAAAAGCAGCTCCCCAGG + Intronic
1095395185 12:41755123-41755145 CTTTGGAAAAACAGTTTTGCTGG + Intergenic
1096236985 12:49935861-49935883 ATGTAGATATGCAGTTTCCCAGG + Intergenic
1096579240 12:52573803-52573825 CTGGAGAAAAGCAGTCTCCAAGG + Exonic
1096579813 12:52577607-52577629 CTGAGGGGAAGCAGTTTCACAGG + Intergenic
1097897233 12:64837240-64837262 CTGTGGAAAAACTGTCTTCCCGG - Intronic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1099404734 12:82246236-82246258 CTATGAAACAGCAATTTCCCAGG - Intronic
1099837533 12:87925913-87925935 CTTTGGAAATACAGATTCCCAGG + Intergenic
1100882846 12:99037742-99037764 GTGTGAAAAAGCTGTTTGCCAGG + Intronic
1102876844 12:116455571-116455593 CTGCCAAAAAGCAGCTTCCCCGG - Intergenic
1102889164 12:116544714-116544736 CTGTGGAAAAATAGTGTCCTGGG - Intergenic
1104397319 12:128445545-128445567 CCGTGGACAGGCAGCTTCCCAGG - Intronic
1104637389 12:130446889-130446911 CTGTGGAAATGCGGGTTGCCTGG + Intronic
1108545391 13:51488352-51488374 ATGTGGAAAAGCAGTTTCTCTGG + Intergenic
1108545447 13:51488857-51488879 TTGTGGACAAGCAGTTTCTCTGG - Intergenic
1109788914 13:67221837-67221859 CTGTGCAAAAACAGGTTCTCTGG + Intronic
1111442480 13:88298085-88298107 CTGAGCAAAAGCAGTACCCCAGG + Intergenic
1112451278 13:99512645-99512667 TTCTGGAAAAGAAGTTTTCCTGG + Intronic
1114705889 14:24726500-24726522 CATGGAAAAAGCAGTTTCCCTGG - Intergenic
1115837350 14:37422880-37422902 CTGTTGAACTGCAGTTTCTCTGG - Exonic
1117541065 14:56746924-56746946 CTGTGGAAAAGCATTTGACTTGG - Intergenic
1117855667 14:60029605-60029627 TTGTGGAAAAGCAGATTACCAGG - Intronic
1118464220 14:66016277-66016299 CTGGGTAAAAGCAGTTTCAGTGG - Intergenic
1119099946 14:71870626-71870648 CTTTGGAAAATCATTTCCCCAGG - Intergenic
1119800609 14:77441709-77441731 GTGGGGAAAAGCAGGTTACCTGG - Intronic
1120501721 14:85305777-85305799 CTGTGAAAAAGCAGGTTAACAGG + Intergenic
1121439036 14:93937216-93937238 CTGTTGAAATGCAGACTCCCCGG + Intronic
1122242999 14:100381627-100381649 AGGTGGAAAAGCACTTTCCGGGG - Exonic
1122585078 14:102800274-102800296 CTTTAGGAATGCAGTTTCCCAGG + Intronic
1123467473 15:20527474-20527496 CTGTGGAAATGCAAATTCCCAGG - Intergenic
1123650641 15:22473568-22473590 CTGTGGAAATGCAAATTCCCAGG + Intergenic
1123741049 15:23282410-23282432 CTGTGGAAATGCAAATTCCCAGG + Intergenic
1123745949 15:23320148-23320170 CTGTGGAAATGCAAATTCCCAGG - Intergenic
1124168356 15:27349810-27349832 CTCTGGGAAAGCAGTTGCACTGG + Intronic
1124230541 15:27942079-27942101 CTCTGGAAAAGCAGTTAGGCAGG + Intronic
1124278220 15:28343465-28343487 CTGTGGAAATGCAAATTCCCAGG - Intergenic
1124304481 15:28568143-28568165 CTGTGGAAATGCAAATTCCCAGG + Intergenic
1124350161 15:28949361-28949383 CTGCGGAAGAGCACTTTCCAGGG + Intronic
1124533365 15:30524613-30524635 CTGTGGAAATGCAAATTCCCAGG + Intergenic
1124574113 15:30892659-30892681 CTGTGGAAAAATCGTTTCCCAGG + Intergenic
1124765292 15:32483032-32483054 CTGTGGAAATGCAAATTCCCAGG - Intergenic
1125448427 15:39782803-39782825 CTGTGGGACCGCTGTTTCCCTGG + Exonic
1127381847 15:58437598-58437620 CAGTGGAAAATCCCTTTCCCGGG - Intronic
1127781702 15:62322032-62322054 GTGAGGAAAAGCAGTTTCTAGGG + Intergenic
1128185755 15:65642280-65642302 CCGTGGAAAAGATGTTTCCTGGG + Intronic
1128556431 15:68635029-68635051 TTGTGGAAATGCAGGCTCCCGGG - Intronic
1128984179 15:72207334-72207356 CAGTAGACAAGAAGTTTCCCTGG + Intronic
1131442740 15:92471274-92471296 CTGTGGAAAACAAGTACCCCTGG - Intergenic
1134064143 16:11216292-11216314 CTGTGGTCAAGCAGTTGGCCAGG + Intergenic
1134213845 16:12300554-12300576 CTGGGGAAAAGCAGTTACATAGG - Intronic
1136123361 16:28156806-28156828 TTGTACAACAGCAGTTTCCCAGG + Intronic
1136732065 16:32423990-32424012 CTGTGGTACTGCAGGTTCCCTGG + Intergenic
1137836523 16:51597618-51597640 CTTTTGAGAAGGAGTTTCCCAGG + Intergenic
1138008173 16:53356179-53356201 CTGTGGAAATGCAAATTCCCAGG - Intergenic
1138376435 16:56567492-56567514 CTGTGAAAATGCAGATTCCTGGG - Intronic
1138620375 16:58206341-58206363 CTATGGAAGAGCAGTTTGGCAGG - Intergenic
1138685123 16:58718409-58718431 CTGGGGAAGAGCTGATTCCCAGG - Intronic
1139401066 16:66681886-66681908 CTGTGGCAAAGGAATATCCCAGG - Intronic
1140532692 16:75680390-75680412 TTTTGGTAAAGCAGTTTCCATGG - Intronic
1141048301 16:80737197-80737219 CTGTGGAACAGCAGTCTACATGG - Intronic
1141095658 16:81161127-81161149 AAGTGCAAAATCAGTTTCCCAGG + Intergenic
1141349243 16:83277415-83277437 CTGTTAAAATGCAGATTCCCTGG - Intronic
1141862939 16:86730325-86730347 TTGTAGAGAAGCAGTTTTCCAGG + Intergenic
1202994329 16_KI270728v1_random:93254-93276 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1203021016 16_KI270728v1_random:405596-405618 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1203039351 16_KI270728v1_random:678754-678776 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1143569919 17:7750367-7750389 CTGTTACAAAGCAGTTACCCCGG + Intronic
1143729758 17:8874425-8874447 CTGTGGGAGAGCCCTTTCCCCGG + Intergenic
1144444529 17:15314747-15314769 CTGTGGCTAAGAAGTTTGCCAGG + Intronic
1146400469 17:32496815-32496837 CTGTGTACATGCAGTTCCCCAGG - Intronic
1148033332 17:44638361-44638383 CTGTGGAAAAACTGTCTTCCAGG - Intergenic
1148163150 17:45463249-45463271 CAGTGGAAATGCAGGTTCCTCGG + Intronic
1150062856 17:62083760-62083782 ATGTGGAGAAACAGATTCCCTGG + Intergenic
1150394382 17:64809901-64809923 CAGTGGAAATGCAGGTTCCTCGG + Intergenic
1151079859 17:71316564-71316586 CTTTTGAAAAGTCGTTTCCCAGG - Intergenic
1151248102 17:72811441-72811463 TTGTGGAAAAATAGTTTTCCAGG + Intronic
1151522597 17:74641105-74641127 CTGTGAAAAAGCATTTGCCAGGG + Intergenic
1151718540 17:75843530-75843552 AGGTGGAAAGGCAGTGTCCCGGG + Intronic
1152273321 17:79338481-79338503 TTCTGGAAAAGCTGTTTCACAGG - Intronic
1152898972 17:82929250-82929272 AACTGGAAAAGCTGTTTCCCAGG + Exonic
1153338815 18:3953082-3953104 CTGAGGTAAAGCAATTTCTCAGG - Intronic
1155055601 18:22179735-22179757 TTTTAGCAAAGCAGTTTCCCAGG + Intronic
1155401775 18:25447398-25447420 ATTTGGAAAAGCTGTTTCCAGGG - Intergenic
1157167291 18:45369888-45369910 CTGTGTTATAGCTGTTTCCCAGG + Intronic
1158121343 18:54051651-54051673 CTGTGGAAATGTAGGTTCCCAGG - Intergenic
1159476349 18:68925109-68925131 CTATGGAAAAGCATTCTACCAGG + Intronic
1159660196 18:71086595-71086617 TTTTGGAAATCCAGTTTCCCAGG + Intergenic
1159773929 18:72582739-72582761 GATTGGAAAAGCAGTTTCCCTGG + Intronic
1161173076 19:2823049-2823071 CTTGGGAAAAGCAGGTTCCTGGG - Exonic
1162477887 19:10911875-10911897 CAGTTGAAAAGCATTTTTCCGGG - Intronic
1163256052 19:16156685-16156707 CTTTGTAAAAGAAGTTTGCCAGG + Intronic
1163263410 19:16204633-16204655 CTTTGGAAATGCAGAATCCCAGG + Intronic
1163919631 19:20276426-20276448 CATGGAAAAAGCAGTTTCCCAGG - Intergenic
1163968294 19:20769119-20769141 CATGGAAAAAGCAGTTTCCCAGG - Intronic
1168459265 19:56539634-56539656 CTGGGGAAGAGCAGTGTCCCTGG - Exonic
927636856 2:24822874-24822896 GTGTGTAAAAGCATTCTCCCTGG + Intronic
927901500 2:26822538-26822560 CTGTGGAAAAGAACTGTACCAGG - Intergenic
927936388 2:27078978-27079000 CTGTGGAGCAGCAGCATCCCCGG + Exonic
928518391 2:32064371-32064393 CTACGGGAAAGCAGTCTCCCGGG - Intronic
929639392 2:43561478-43561500 CTGTGGAAAAACAGGTTTCATGG + Intronic
930582424 2:53228373-53228395 ATGTCGAAAAGCATTTTCTCTGG - Intergenic
932282527 2:70506448-70506470 CTGTTGAAATGCAGATTCCTAGG - Intronic
932457816 2:71860813-71860835 CTGTTGAATAGGAGTTTGCCAGG + Intergenic
932826655 2:74947687-74947709 CATGGAAAAAGCAGTTTCCCCGG - Intergenic
934313661 2:91895250-91895272 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
934622953 2:95826706-95826728 CATGGAAAAAGCAGTTTCCCAGG + Intergenic
934810813 2:97275382-97275404 CATGGAAAAAGCAGTTTCCCAGG - Intergenic
934826879 2:97432557-97432579 CATGGAAAAAGCAGTTTCCCAGG + Intergenic
936978516 2:118242514-118242536 CAGTGGAACTGCAGCTTCCCAGG + Intergenic
937232447 2:120405994-120406016 CAGTGGAAAAGCAGGCTCCTGGG + Intergenic
937298551 2:120824433-120824455 CTGAGGATCAGCAGCTTCCCGGG - Intronic
937298793 2:120825948-120825970 CTGTGGCCCAGCAGTGTCCCAGG + Intronic
938210343 2:129461519-129461541 CTGTATAAAAACAGTTTCCAAGG + Intergenic
939278328 2:140030558-140030580 CTGTGCAAAAGCACTGTGCCAGG - Intergenic
939941475 2:148356777-148356799 CTCTGGAAGAGCAGTTCCCAAGG - Intronic
940186074 2:150986000-150986022 CTGTGCCAAGGCAGTTTCCTTGG - Intergenic
942058813 2:172208968-172208990 CTCTGGAATAGCAGTTTTCAAGG + Intergenic
942606653 2:177698906-177698928 CTATGGAAAAGCAGTCACCTGGG + Intronic
942795886 2:179818873-179818895 CTGGGGAAGAGCAGCTCCCCTGG - Intronic
944884278 2:204047203-204047225 CTGTGGAAAACCTGTCTTCCAGG - Intergenic
945343996 2:208691263-208691285 CTTTGGAAAAGAAGTGTTCCAGG + Intronic
945601466 2:211871120-211871142 CTGTGGAAAGGCAGATTATCAGG + Intronic
946826777 2:223687276-223687298 TTGTGGAAATGCAGATTCCAAGG - Intergenic
947039174 2:225895695-225895717 CTGTTAAAATGCAGCTTCCCAGG + Intergenic
947139281 2:227006440-227006462 CTGGGGAAAAGCAGTCTGTCTGG + Exonic
947273776 2:228368841-228368863 TTGTCCAAAAGCAGTTTCCATGG - Intergenic
947315899 2:228857915-228857937 CTTTGGAAATGCAATTTCTCAGG - Intronic
947669706 2:231928546-231928568 CTGTGGCAGAGCCGATTCCCTGG + Intergenic
947766940 2:232643964-232643986 CTGTGGAACATCATTTTCACTGG + Intronic
948055101 2:235005176-235005198 CTGTGGAAAGGCAGCTTCCTGGG + Intronic
948226352 2:236312192-236312214 CTGTGGAAAAGCAGATTCAGTGG - Intergenic
948888758 2:240896838-240896860 CTGGAGAAAAGCAGTCTCCGTGG + Intronic
948911202 2:241003542-241003564 GTGTGGAAAAGCTGACTCCCAGG - Intronic
948968020 2:241399873-241399895 GTATGGATATGCAGTTTCCCTGG + Intronic
1169687274 20:8289363-8289385 CAGTGGAAATGCAGTTCCTCAGG - Intronic
1171228293 20:23459805-23459827 CTGTGGAAATGCAGTCTACAGGG - Intergenic
1171474573 20:25398275-25398297 GTCTGCAAAAGCAGTTTGCCAGG + Intergenic
1172686962 20:36763090-36763112 CTGTGAAAAAGCAGTTTAAAAGG + Intronic
1178259015 21:31081571-31081593 TTGTGGAAATGCAACTTCCCAGG + Intergenic
1178829371 21:36042691-36042713 CTGTAGAGAAGCAGTTTTCTAGG - Intronic
1180057116 21:45364734-45364756 CTCTGGAAGAACAGTTTCCTGGG - Intergenic
1180209233 21:46284446-46284468 GTGTGAAGAAGCTGTTTCCCAGG - Exonic
1180540404 22:16441155-16441177 CTGTGGTACTGCAGGTTCCCTGG - Intergenic
1180655685 22:17418890-17418912 CTGTGGAAATGAAGTGGCCCAGG - Intronic
1180717795 22:17883682-17883704 CTTAGGATAAGCAGTTTTCCAGG + Intronic
1181172316 22:21016613-21016635 CTTTGGAAATGCAGTTTCTCTGG - Intronic
1181177058 22:21043908-21043930 CTTCGGAAATGCAGTTTCTCTGG + Intergenic
1181422397 22:22810923-22810945 CTGTGCAAAGGCTGTGTCCCTGG + Intronic
1181546971 22:23607650-23607672 CTGTGGAAATGCATGTTCCCAGG + Intergenic
1181557985 22:23683116-23683138 ATGTCAAACAGCAGTTTCCCTGG - Intergenic
1182031893 22:27165726-27165748 TTGTGGAAATGCAGATTCCTGGG + Intergenic
1182447554 22:30398304-30398326 GTTTGGAGGAGCAGTTTCCCTGG + Intronic
1185244134 22:49764265-49764287 CTGTGGAGCAGCAGGTCCCCTGG - Intergenic
950142442 3:10624801-10624823 CTGAGGAAAAGCACTTTCTAAGG + Intronic
950146658 3:10654836-10654858 TTGTGAAAATGCAGTTTCCTTGG - Intronic
950239628 3:11357226-11357248 TTGTGGAAAGTCAGTGTCCCTGG + Intronic
950329085 3:12141954-12141976 CTGTGGATATGCAGGTTCTCCGG + Exonic
950758947 3:15203282-15203304 CTGCAGAAATGCAGATTCCCAGG + Intergenic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
951515461 3:23554328-23554350 ATGTGGCAATCCAGTTTCCCCGG - Intronic
952924139 3:38308997-38309019 CAGCGAAAAAGCAGTGTCCCAGG - Exonic
953156356 3:40378239-40378261 ATGTGGATATCCAGTTTCCCAGG - Intergenic
954411291 3:50372337-50372359 GTATGGAAAAGGTGTTTCCCTGG - Intronic
954683081 3:52356339-52356361 CTTTGGAAGAGCAGCTCCCCCGG + Intronic
955072612 3:55584473-55584495 CAGAGGAAAGGCAGTTTCCCTGG + Intronic
957569101 3:81923295-81923317 ATGTGGAAAAGAAGTTCACCAGG - Intergenic
958656553 3:97009770-97009792 CACAGAAAAAGCAGTTTCCCTGG + Intronic
959027786 3:101260746-101260768 ATGTTAAAAAGAAGTTTCCCTGG - Intronic
960428463 3:117538463-117538485 CTGTGGCAATGCTGCTTCCCTGG + Intergenic
960489067 3:118288845-118288867 CTTTTGAAAAGCAGTTTTTCTGG + Intergenic
960704756 3:120471118-120471140 GTGTGGAAAAGCACTCTCCATGG - Intergenic
961392109 3:126558344-126558366 CTGTGGTAATGCTGCTTCCCCGG - Intronic
966183876 3:177211080-177211102 CCCTTGATAAGCAGTTTCCCTGG - Intergenic
966250583 3:177860602-177860624 CATGGGAAAAGCAGTTTCCCTGG + Intergenic
967014193 3:185466837-185466859 CAGTGGAAAAGAAGTATCCTGGG + Exonic
967378663 3:188833206-188833228 CTCTGCATCAGCAGTTTCCCTGG - Intronic
967771182 3:193334977-193334999 CTGTGGAACAGAAGTTATCCAGG - Exonic
973222069 4:47737965-47737987 CAGTGCAAAAGCCTTTTCCCCGG + Intronic
973637022 4:52869918-52869940 CTGTGCAACACCAGTTTTCCTGG - Intergenic
974055801 4:56981545-56981567 CTGTGGAAAAAGAGTTTATCAGG + Intronic
976139381 4:81974635-81974657 CTGTGAAAAAGAATTTCCCCTGG + Intronic
977945869 4:102913305-102913327 CTGTGGCACTGCAGGTTCCCTGG - Intronic
978758910 4:112334130-112334152 CTGAAGAAAAACAGTTTTCCAGG + Intronic
980499168 4:133626604-133626626 CTGTGGCAAAACAGGTGCCCTGG + Intergenic
980744728 4:136999646-136999668 ATGTGGAAAAGCAGTTTCCTAGG + Intergenic
981067293 4:140498339-140498361 CTGTGGCAAGGCGGCTTCCCAGG - Intronic
981474051 4:145170165-145170187 ATGTGAAAATGCAGATTCCCTGG - Intronic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983507799 4:168573794-168573816 GTGTGGAAAAACAGTAACCCTGG + Intronic
984073245 4:175143297-175143319 ATGTGGAAATCCAGTTTTCCTGG + Intergenic
984215688 4:176910634-176910656 CATAGGAAAAGCAGTTTCCCTGG - Intergenic
984706950 4:182854524-182854546 CTTAGGAAATGCTGTTTCCCTGG - Intergenic
985766823 5:1784469-1784491 CAGGGGAAAAGCAGGTGCCCAGG - Intergenic
986982520 5:13465584-13465606 CTCTGCAAATGGAGTTTCCCAGG - Intergenic
987200567 5:15572870-15572892 CTGTGGAAAAGCAGTCACAAAGG - Intronic
989150349 5:38292953-38292975 CTGGTGAAAAGCAGCTTCACTGG + Intronic
989854978 5:46273491-46273513 ATGTGACAAAGCAGTTTCTCAGG + Intergenic
990596956 5:57321796-57321818 CAGTGGAAAAGGAGGTTCCAGGG - Intergenic
991187301 5:63825142-63825164 CTGTGGAAAAATTGTCTCCCAGG - Intergenic
991417689 5:66408736-66408758 CTGAGGAAAAGCAGGTGCCATGG - Intergenic
992189213 5:74274484-74274506 ATGTGGAAAATGAGTTTCTCAGG - Intergenic
992827574 5:80566224-80566246 CTGTGGGTAAGCAGCCTCCCTGG - Intronic
994620116 5:102153213-102153235 CTGTGTAAAAGCAGAATCCACGG + Intergenic
995225181 5:109692763-109692785 CTGTGGAAAAACTGTCTTCCAGG - Intronic
996753540 5:126913307-126913329 CTGTGGGAAGCCAGCTTCCCTGG + Intronic
996792486 5:127307523-127307545 CTGTGGGGCAGCTGTTTCCCTGG + Intronic
997358446 5:133279416-133279438 CTGTGGAAAAACGGTCTTCCAGG + Intronic
998534956 5:142921185-142921207 CTGTGCAAATGCAGGTTACCTGG - Intronic
999105557 5:149067934-149067956 CTTTGCAAAAGAAGTTTCACTGG + Intergenic
1001425090 5:171617671-171617693 AGGTGGAAATGCATTTTCCCTGG - Intergenic
1001712448 5:173789483-173789505 CTGTGGATAAGCACTTGGCCAGG - Intergenic
1001783074 5:174387150-174387172 CAGTGGAAAAGGGGTGTCCCAGG - Intergenic
1002142254 5:177149585-177149607 CTGTGGAAAAACTGTTTCCCAGG - Intronic
1002510268 5:179711440-179711462 CTGTGGAAAAGAAGTTTTTTGGG - Intronic
1002885005 6:1285756-1285778 CGGAGGAAATGCAGCTTCCCTGG - Intergenic
1006251631 6:32792030-32792052 CTGTGTAAATGCAGATTCTCTGG + Intergenic
1007286156 6:40748926-40748948 CTGAGGAAAAGAGGTTTCCCTGG - Intergenic
1008468330 6:51855092-51855114 CGTGGAAAAAGCAGTTTCCCCGG + Intronic
1008792243 6:55250528-55250550 CTGTGAAACAGAAGATTCCCTGG + Intronic
1009766750 6:68086847-68086869 CTCTGGAAGAGCATTGTCCCTGG - Intergenic
1010903006 6:81450997-81451019 TTGTGAAAATTCAGTTTCCCAGG - Intergenic
1011143282 6:84184441-84184463 AAGTGGACAAGCAGTTTCCATGG - Intronic
1014084697 6:117329802-117329824 CTTTGGAAAAGCAATTTCCCCGG - Intronic
1014744993 6:125190475-125190497 CTGTGGAAAAACTGTCTTCCAGG - Intronic
1015323124 6:131898275-131898297 CTTTGCAAAGGCAGTTTCACAGG + Intergenic
1015506781 6:133996750-133996772 CTGTGCACAAGCAGGTTCCATGG + Intronic
1016561943 6:145405782-145405804 CTGTTGAATAGCTGTTTTCCAGG + Intergenic
1016617906 6:146074312-146074334 CTGTGGAAAAGCAGGTGACTAGG - Intronic
1019655516 7:2192611-2192633 CTGTGGAGAATCAGTTCCCTAGG - Intronic
1019870061 7:3751843-3751865 AAGTAGAAAACCAGTTTCCCAGG - Intronic
1021443565 7:20708186-20708208 CTGTGGAAAAGTCATTTCCATGG - Intronic
1022118100 7:27279826-27279848 CTCTAGGAAAGCACTTTCCCAGG + Intergenic
1026507445 7:70997413-70997435 CTTTGGAAAATCTGTTCCCCAGG + Intergenic
1029018643 7:97340730-97340752 AAGTGGAAAAACAGTTTTCCTGG + Intergenic
1030162081 7:106519312-106519334 CTGTGGCAAAGAAGTTTCAGGGG - Intergenic
1032473982 7:132199917-132199939 CAGTGGAAAAACAGCTTCCCTGG + Intronic
1032490291 7:132319229-132319251 TTGTGAAAATGCAGCTTCCCAGG + Intronic
1033558669 7:142510546-142510568 TTGTTGAAAGGCAATTTCCCAGG + Intergenic
1035079706 7:156205654-156205676 CAGTGGAAAAGTGGTTTCCTGGG + Intergenic
1035749435 8:1985436-1985458 CTGTGGAAGAGCATCTCCCCTGG - Intronic
1036664056 8:10727408-10727430 CTGTGGCTAAGCAGGTGCCCTGG - Intronic
1036739228 8:11346748-11346770 CTGTTAAAATGCAGATTCCCTGG + Intergenic
1037760500 8:21738568-21738590 CTGGGGAAAATCAGACTCCCTGG + Intronic
1038912731 8:31984901-31984923 CTGTTGAAAAGCATTTGCACTGG + Intronic
1039055484 8:33533095-33533117 CTGAGCAAAAGCAGTTTTGCTGG - Intergenic
1039265073 8:35815563-35815585 CTTGGAAAAAGCAGTTTCCCAGG - Intergenic
1039618563 8:38975970-38975992 CTCTGAAGAAGCAGTGTCCCTGG + Intronic
1040345338 8:46487229-46487251 GTCTGCAAAAGCAGTTTGCCAGG + Intergenic
1040711843 8:50198228-50198250 CTGGGAGAAAGCAGTCTCCCGGG + Intronic
1040809236 8:51432190-51432212 CTGTGGATAATGAGTTGCCCAGG + Intronic
1045300951 8:100909436-100909458 CAGTTGAAATGCAGTTTCCTGGG + Intergenic
1045637626 8:104210682-104210704 GTGTGGAAATGCAGTATCACAGG + Intronic
1045823732 8:106372192-106372214 CATGGAAAAAGCAGTTTCCCTGG + Intronic
1048151979 8:131903369-131903391 TTGTTGAAAAGCAGATTCCTAGG - Intergenic
1048583444 8:135750149-135750171 CTGTGGAAAAATTGTCTCCCAGG + Intergenic
1050667811 9:7961063-7961085 CTCTGGAAAAGGAATTTCCTGGG + Intergenic
1050677490 9:8072262-8072284 CTGTTGAAATGCACATTCCCGGG - Intergenic
1052385914 9:27823615-27823637 TTGTGGAAATTCAGCTTCCCAGG - Intergenic
1056551230 9:87654517-87654539 GTGTGGAAGGGCAGTATCCCAGG + Intronic
1058268130 9:102933243-102933265 CTTTGGAAGGGCAGTTTGCCTGG - Intergenic
1058934517 9:109755841-109755863 CTGTGCAAAAGCACTGTTCCAGG - Intronic
1060345954 9:122815987-122816009 CTGTGGAAAAATTGTTTTCCAGG - Intronic
1060445165 9:123680910-123680932 CTGTGGACCAGCATTCTCCCAGG - Intronic
1060455877 9:123796065-123796087 CTGTTGAAAAGTATTTTCCTGGG - Intronic
1061231413 9:129318057-129318079 CAGTGGAAAAGGACTTCCCCTGG - Intergenic
1061855809 9:133441428-133441450 GTGTAAAAAAGCAGATTCCCGGG + Intronic
1186266182 X:7836438-7836460 ATTTGGGAAAGCAGTTTGCCAGG - Intergenic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1186430859 X:9503266-9503288 CTGTGGAAAAGCAGTTTCCCCGG - Intronic
1186601228 X:11039499-11039521 CTGTTAAAATGCTGTTTCCCAGG + Intergenic
1186784902 X:12948212-12948234 CTGTGGAAGTGCAGTTTCCTGGG - Intergenic
1187568797 X:20479342-20479364 CTGTGGAAAACCAGGTCCACTGG - Intergenic
1189288442 X:39868298-39868320 CTTTTGAAAACCAGCTTCCCAGG + Intergenic
1189986791 X:46560609-46560631 CTTTGGAAAAACAGTTTGGCAGG - Intergenic
1192605359 X:72510961-72510983 GTTTCCAAAAGCAGTTTCCCAGG + Intronic
1192798492 X:74444105-74444127 CTGAGGGAAAGGAGTTTCCCTGG + Intronic
1195284575 X:103371610-103371632 GTGTGAAAAATCAGGTTCCCTGG + Intergenic
1198132820 X:133715612-133715634 CTGTGCAAAAGCCTTTTCCCTGG + Intronic
1198972761 X:142299952-142299974 CTTTGGGAAAGCAGTTTCAGGGG - Intergenic
1199548382 X:149032114-149032136 CTGTGGCAAATCAGTTCCCCAGG + Intergenic
1199737936 X:150702284-150702306 CTGTAAAAATGCAGCTTCCCGGG + Intronic
1199886506 X:152026542-152026564 TTGTGGAAATGCAGTGTCTCTGG - Intergenic
1201181576 Y:11352745-11352767 CTGTGGTACTGCAGGTTCCCTGG - Intergenic