ID: 1186431676

View in Genome Browser
Species Human (GRCh38)
Location X:9510392-9510414
Sequence AGGAGGGGGGCTTTTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186431663_1186431676 14 Left 1186431663 X:9510355-9510377 CCTTGGACACTGGACTAATCCAA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG 0: 1
1: 0
2: 1
3: 25
4: 183
1186431670_1186431676 -5 Left 1186431670 X:9510374-9510396 CCAAGAAGTTGGGTGGGGAGGAG 0: 1
1: 0
2: 3
3: 42
4: 357
Right 1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG 0: 1
1: 0
2: 1
3: 25
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186431676 Original CRISPR AGGAGGGGGGCTTTTTCTTT AGG Intronic
900649540 1:3724087-3724109 AGGCTGGGGGCTTTGACTTTTGG + Intronic
904355690 1:29937712-29937734 AGGAGGGGGCATGTTTATTTTGG + Intergenic
905701412 1:40018532-40018554 GGGAGGGGGGACTCTTCTTTGGG + Intergenic
907575338 1:55521271-55521293 AGGAGGTAGGCTTTTTCTTGAGG - Intergenic
908022922 1:59916927-59916949 AGGAAGGGGGCATTCTCATTTGG - Intronic
909591095 1:77350439-77350461 AGGAGGAAGGGTTTTTCTGTTGG + Intronic
909984161 1:82140120-82140142 AGTATGGGGGCTTTTTGTTCCGG + Intergenic
910539305 1:88337067-88337089 AGGAGGGGGCCTTTTTAGATTGG - Intergenic
912204433 1:107494570-107494592 AGGAGGGGGGCATATTAGTTTGG - Intergenic
912361617 1:109100415-109100437 AGGAGGAGAGCTTTTCATTTCGG - Intergenic
914812094 1:151036506-151036528 AGGAGGCAGGGTTTTTCTTTTGG + Intergenic
914980840 1:152413053-152413075 AGGAGGGGGGAACCTTCTTTGGG + Intronic
915372446 1:155362694-155362716 AGGATTGGGGTTTTTTCTATAGG - Intronic
915978791 1:160407661-160407683 AAGAGGGGGGCATTTGTTTTTGG + Intronic
917083915 1:171286234-171286256 AGCAGGTAGGCTTTTTCCTTTGG - Intergenic
917132662 1:171758459-171758481 AGGGGTGTGACTTTTTCTTTTGG + Intergenic
917796210 1:178534566-178534588 AGCAGGGGGGCTTCTTAATTGGG - Intronic
918302813 1:183219455-183219477 AGGAGGGGGGCATTGTCACTGGG - Intronic
919715375 1:200770394-200770416 AGTAGGGGGACATTTTGTTTTGG - Intronic
920605359 1:207377928-207377950 AAGAGGTGGGGTTTTCCTTTTGG - Intergenic
921152322 1:212412440-212412462 CTGAGGGGGGATTTTTCCTTGGG - Intronic
924718747 1:246603801-246603823 AGGATGTGGGATTTCTCTTTGGG + Intronic
1063023748 10:2156665-2156687 GGGAGGGAGGCTTTTTGTCTGGG + Intergenic
1063583127 10:7327329-7327351 AGAAGGAGGGATTTTTTTTTCGG - Intronic
1073007183 10:100333461-100333483 AGGAAGGGTTCTTTTTCATTTGG + Intergenic
1074345978 10:112686891-112686913 AGAAGGTGGAATTTTTCTTTAGG + Intronic
1074925009 10:118059775-118059797 TGGAGGGCTGCTTTTTCATTTGG - Intergenic
1075929737 10:126285661-126285683 AGGAGGGAAGCTTTGTCGTTGGG + Intronic
1076128171 10:127992450-127992472 AGCTGGGGGTCTCTTTCTTTGGG + Intronic
1078597782 11:12703270-12703292 AGGATGGGGGCTTTGGTTTTTGG + Intronic
1081637740 11:44731964-44731986 AGGAAGATGGCTTTTTATTTGGG - Intronic
1082775260 11:57239878-57239900 AGGATTGGGCGTTTTTCTTTGGG - Intergenic
1084329471 11:68422345-68422367 GGGAGGGGAGCTTTTCCTTCAGG + Intronic
1085478623 11:76804255-76804277 AGGAGGGTGGCTTTTTCATTTGG - Intergenic
1085742008 11:79085385-79085407 AAAAGGGGGGTTTTTTTTTTGGG + Intronic
1087194163 11:95287843-95287865 AGGAGGATGGCTTTTTTTTTTGG + Intergenic
1087849339 11:103010362-103010384 AGGAGTGGGGCTTTTCCATAAGG - Intergenic
1087968165 11:104444997-104445019 AGGAGTGGGGAATCTTCTTTAGG - Intergenic
1088220099 11:107561420-107561442 AGGAGAGAGGCTATTTCTGTGGG + Intronic
1089135926 11:116249120-116249142 AGGAGGAGGCCTTTTCCTTAAGG - Intergenic
1091135829 11:133188272-133188294 AGGAGGGGGACTGTATCTTTGGG + Intronic
1091757078 12:3060813-3060835 AGGAGAGGGGCTTGGACTTTGGG - Intergenic
1091934351 12:4423419-4423441 AGCTGGGGGGCCTATTCTTTTGG - Intergenic
1093505526 12:19861132-19861154 AGGAGTGTGTCTTTTTCCTTTGG + Intergenic
1094491767 12:30965196-30965218 AGGAGAGGGGTTCTTTCTCTGGG - Intronic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1097283736 12:57862068-57862090 AGGAGGGGGTCTCCTTCCTTGGG - Intergenic
1097741419 12:63247006-63247028 AGGAGGAGAGCTTTTGCTGTGGG + Intergenic
1101330256 12:103751680-103751702 AAGAGCTTGGCTTTTTCTTTAGG + Intronic
1101839372 12:108316795-108316817 ATGGGTGGGGCTTTTGCTTTGGG + Intronic
1103535853 12:121633356-121633378 TGGCGGGGGGCTGTTTATTTTGG + Intronic
1104159808 12:126167557-126167579 AGGAGAGTGGCTTTCCCTTTAGG - Intergenic
1105426556 13:20299654-20299676 AGTGGAGGGACTTTTTCTTTCGG + Intergenic
1108526503 13:51290181-51290203 AGGAGGATGGCTTTTGCTTCTGG + Intergenic
1114731839 14:25001107-25001129 AAGACGGAGGCTTTTTCTCTTGG + Intronic
1115589234 14:34847484-34847506 AGGAGGGGGACTTCTTATTTCGG - Intronic
1119144966 14:72303955-72303977 AGTAGGGAGCCTTTCTCTTTGGG - Intronic
1121500284 14:94430421-94430443 GGGAGGAAGGCTTTTTATTTGGG + Intergenic
1121945387 14:98116181-98116203 AGGAAGAGGGCATTTTCATTTGG + Intergenic
1127092635 15:55481794-55481816 GAGAGGTGGGGTTTTTCTTTTGG - Intronic
1127104096 15:55595024-55595046 AGGAGGGGGACCTCTTCTTTAGG - Intergenic
1127533706 15:59869692-59869714 AGGAAGGGTGCTTTTCCTTGGGG + Intergenic
1130971827 15:88739686-88739708 AGGTGGGGGGCTTCTTCCTGTGG + Intergenic
1131347901 15:91667990-91668012 AGGAGTTGGGCATTTTCTATAGG + Intergenic
1134324827 16:13197738-13197760 TGGAGGGGGGAATTTTCTTGTGG + Intronic
1134396358 16:13867922-13867944 GGGATGTGGGCTTTTTCTTTTGG + Intergenic
1134410828 16:14001961-14001983 ATGAGAGGGGCTTTTTGTTATGG - Intergenic
1134768590 16:16784275-16784297 AGGATAAGGGCTTTTTATTTGGG - Intergenic
1137707459 16:50545393-50545415 TGGAGGGGGGCTTTGTGTCTGGG + Intergenic
1138127116 16:54448036-54448058 GGGCAGAGGGCTTTTTCTTTGGG + Intergenic
1138404488 16:56778677-56778699 AGGATGGGTGCTTTTTGTTGAGG + Intronic
1141010967 16:80398527-80398549 TGCTGGGAGGCTTTTTCTTTTGG - Intergenic
1141581751 16:85004191-85004213 AGGGCGGGGCCTTTTTTTTTGGG - Intronic
1143684301 17:8501641-8501663 GGGAGGAGGGCATTATCTTTTGG + Intronic
1143967908 17:10770135-10770157 AGGAGTGGGACTATGTCTTTTGG - Intergenic
1144293181 17:13846082-13846104 AGAGAGGGGGCTTTTCCTTTTGG + Intergenic
1144644464 17:16962823-16962845 AGGAGGGGTGCGTTTTCAGTTGG - Intronic
1147211354 17:38874262-38874284 AAGAGGGGGGCTCTTGCTCTGGG + Intronic
1148822495 17:50367683-50367705 AGGAGGGGAGCTTGTGCTTGAGG - Intergenic
1149478377 17:56982401-56982423 AGGGAGGGGCCTTTCTCTTTTGG + Intronic
1154091447 18:11367662-11367684 TTGAGGTGGTCTTTTTCTTTTGG + Intergenic
1155087328 18:22471187-22471209 AGGAGGGGGACTTCTTCCTCAGG + Intergenic
1155369208 18:25080120-25080142 AAAAGCGGGGCTTTTTCCTTGGG - Intronic
1156436506 18:37135963-37135985 AGGTGTGTGGCTTTATCTTTGGG + Intronic
1158307077 18:56117556-56117578 AGGAGGGGGGATTACTTTTTGGG - Intergenic
1165054060 19:33162532-33162554 AGGAGTGGGGTGTTTTCTTTGGG - Intronic
1165262804 19:34635471-34635493 AAGATGGGAGCTTTTTCTGTAGG + Intronic
1165573147 19:36792176-36792198 TGGGGGTTGGCTTTTTCTTTTGG - Intergenic
1165955201 19:39498107-39498129 GGGAGGGTGGCTTTGTCTTGCGG + Intergenic
1167310035 19:48731862-48731884 AGAAAGGGGGCTTTTATTTTGGG - Intronic
1167948408 19:53007837-53007859 AGGGGAGGGGCTTTTCCTCTCGG + Intergenic
926793705 2:16601155-16601177 AGGAAGGGAGGTGTTTCTTTAGG + Intronic
927860935 2:26559501-26559523 AGGAGGGGGCAGTTCTCTTTTGG - Intergenic
930223861 2:48772180-48772202 AGGAAAGGGTCTTTTTTTTTAGG + Intronic
931015641 2:57977024-57977046 AGGAGTGTGGCTTTATCTCTTGG + Intronic
931085843 2:58830258-58830280 GGGTGGGGGGCTGTTTGTTTGGG - Intergenic
931247342 2:60502527-60502549 AGGAAGCTGGCTCTTTCTTTAGG - Intronic
932129120 2:69171585-69171607 AGGGTTGTGGCTTTTTCTTTTGG + Intronic
935119924 2:100175554-100175576 AGGAGGCGGAGTTTTTGTTTTGG - Intergenic
935298533 2:101672370-101672392 GGGGGGGGGGGTTTGTCTTTTGG + Intergenic
935865990 2:107388396-107388418 AGCAGGGTTGCTTTTTTTTTTGG + Intergenic
936660475 2:114537492-114537514 AGAAGGGAGACTTTTTTTTTTGG + Intronic
937895717 2:126975491-126975513 GGGAAGGAGGCTTTTTATTTGGG - Intergenic
939630662 2:144523670-144523692 AGGAGGTGGGCAACTTCTTTTGG + Intronic
948836936 2:240630422-240630444 AGGAGGGCGGCTTCTGCTTCAGG + Exonic
949062201 2:241967893-241967915 GGGAAGGGGGCTGTGTCTTTGGG - Intergenic
1169675985 20:8155655-8155677 AGCAGTGGGGCTTTCTCTTTGGG + Intronic
1171174970 20:23044920-23044942 AGAAGAGGGGCATTTTCTTAAGG - Intergenic
1171226240 20:23444196-23444218 AGGAGGGAGGCTTTATATTTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174108584 20:48181447-48181469 AGGATGGGGATTTTTGCTTTGGG + Intergenic
1175028335 20:55927191-55927213 GGGAGGGGGGCATTTTTGTTGGG + Intergenic
1176898404 21:14411002-14411024 AGGTGTGTGGCTTTTTCTCTTGG + Intergenic
1177590248 21:23154603-23154625 TGGAGAGGGCATTTTTCTTTTGG + Intergenic
1179263521 21:39780308-39780330 AGGAAGGAAGCTGTTTCTTTGGG + Intronic
1179450960 21:41468056-41468078 AGGATGGGGGCTATCTCTTTGGG - Intronic
1179833143 21:44011188-44011210 TCGAGGTGGTCTTTTTCTTTGGG - Intergenic
1180715104 22:17866217-17866239 TGAAGGGGGTCTTTTCCTTTGGG + Intronic
1180918786 22:19507561-19507583 AGCAGAGGGGCTTTTCCCTTGGG - Intronic
1181047102 22:20220342-20220364 AGGGGGGGGGCTTTGTCTCAAGG - Intergenic
951026954 3:17840700-17840722 AGGAGGGAGGCTTCTTACTTGGG + Intronic
951497188 3:23342981-23343003 AGGAATGGTGCTTATTCTTTTGG + Intronic
953471446 3:43170022-43170044 AGGAAGGGGGCTTCTTTCTTTGG + Intergenic
953590906 3:44252795-44252817 AGGAGGGAGGCGTCTTCATTTGG + Intronic
955609711 3:60744045-60744067 GGAAGGGGGGCTATTTGTTTTGG + Intronic
958973699 3:100641352-100641374 CTGAGGTGGTCTTTTTCTTTTGG + Intronic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
963448913 3:145452196-145452218 AGGATGGGGACTTTTTTTCTGGG - Intergenic
964151841 3:153535006-153535028 AGGTGTGTGGATTTTTCTTTGGG - Intergenic
964193280 3:154031523-154031545 AGGAAGGGGAATTTTTATTTTGG + Intergenic
964278336 3:155032951-155032973 CTGAGGTGGTCTTTTTCTTTTGG + Intronic
964438813 3:156682323-156682345 AGGACAGGGTTTTTTTCTTTTGG + Intronic
966241559 3:177759798-177759820 AGGGGGGTGGATTTTCCTTTTGG - Intergenic
968384015 4:120788-120810 GGGACGGGTTCTTTTTCTTTCGG - Intergenic
969204481 4:5633097-5633119 AGGAGAGGGTCTCTCTCTTTAGG - Intronic
969248314 4:5950660-5950682 AGGAGGGTGACCTTTTCTATTGG - Intronic
969313759 4:6369591-6369613 AGGCAGGGGGCTTTCTCTTGGGG - Intronic
969339448 4:6531055-6531077 AGGAGGGGTGATCTTTCTTGGGG - Intronic
969460252 4:7325189-7325211 AGGTGGGGGGCTTTTCATCTTGG + Intronic
969667211 4:8566613-8566635 AGAAGGTGGGGTTTTTGTTTTGG - Intronic
970129347 4:12849836-12849858 AGAAGGAGGGCTTATTCCTTAGG + Intergenic
978555168 4:109972098-109972120 AGGAGGGTGAGTTTTTCTCTTGG + Intronic
978652871 4:111028604-111028626 ATGAGTGTGGGTTTTTCTTTTGG - Intergenic
979869569 4:125802084-125802106 AGGAAGTTGGCTTTTTCTTCAGG + Intergenic
980124212 4:128758064-128758086 TAGAGGTTGGCTTTTTCTTTTGG - Intergenic
982126821 4:152190891-152190913 AGGGGTTGGGCTTTTTCTTAAGG + Intergenic
984156677 4:176203058-176203080 AGGGGGGGGGCTCATCCTTTTGG + Intergenic
987076706 5:14389397-14389419 AAGTGAGTGGCTTTTTCTTTGGG + Exonic
987297349 5:16565475-16565497 GGGAGGGAGGCATTTTCTTTTGG - Intronic
989208594 5:38836085-38836107 AGGAGGGCTGATTTTTCTTATGG - Intergenic
994273520 5:97809144-97809166 ATGAGGCAGGCTTTTTCTCTTGG + Intergenic
997799306 5:136843842-136843864 AAGAGGGAGGCTTTTCCATTGGG + Intergenic
998164314 5:139834119-139834141 ATGAGGGGGGCTTTTCCTTGTGG - Intronic
999149744 5:149418889-149418911 AGCAAGGGGGCTTCTCCTTTTGG - Intergenic
999501193 5:152148290-152148312 AGGAAGGGGTCTTTCTCTCTAGG + Intergenic
999679955 5:154047497-154047519 TTGTGGGGGGCTTTTTGTTTTGG + Intronic
1000289399 5:159856078-159856100 GGGAAGGTTGCTTTTTCTTTTGG - Intergenic
1000802365 5:165744339-165744361 AGGAAGATAGCTTTTTCTTTTGG - Intergenic
1001925584 5:175633859-175633881 ATGAGGGGGTCTTGTTCATTTGG + Intergenic
1004496030 6:16163996-16164018 AGGGGAGGAGCTTTTTCTGTTGG - Intergenic
1004885969 6:20051932-20051954 AAGAGTGGTGCTTTTTCATTAGG + Intergenic
1005573696 6:27172138-27172160 AGGAGGGGGGATTTATTTTCAGG - Intergenic
1008847170 6:55981551-55981573 TGAAGGGGTGCTATTTCTTTGGG + Intergenic
1009500989 6:64413564-64413586 GGGAGGGGAGGTTTTTTTTTGGG - Intronic
1009608001 6:65898535-65898557 AGGAGGAGGTCTTTCTCTTTAGG + Intergenic
1011170546 6:84499898-84499920 AGGAGAGTGGCTTTTACTTTGGG + Intergenic
1016505616 6:144775854-144775876 AGGAGGGGGTTTTTTTCTTCAGG - Intronic
1018002569 6:159592554-159592576 ACAAGGGGGACTTTTTTTTTTGG + Intergenic
1020200307 7:6074493-6074515 GGGAGGGGGGCTTGTTCTTGAGG + Intergenic
1022256170 7:28660810-28660832 AGGAGGATGGCTTTTTCCTTTGG - Intronic
1022610521 7:31867210-31867232 AGGTGGGGGGTTTTGTCCTTAGG - Intronic
1023087085 7:36581570-36581592 AAGAGGGGTTATTTTTCTTTGGG + Intronic
1023268653 7:38435758-38435780 AGGAGGGGAGCTTCTTCAATGGG + Intronic
1024874329 7:54004643-54004665 AGGAGGGAGGCATTTACGTTGGG + Intergenic
1026139839 7:67696394-67696416 AGGAGAGGTGTTTTTACTTTTGG - Intergenic
1027266713 7:76498662-76498684 CTGAGGGGGGCCTTTTCCTTTGG - Intronic
1027318093 7:76996779-76996801 CTGAGGGGGGCCTTTTCCTTTGG - Intergenic
1030626208 7:111848774-111848796 GAGAGGGGGGTTTTTCCTTTTGG - Intronic
1030710764 7:112746352-112746374 AAAAGGGAGGCTTTTTTTTTTGG - Intergenic
1030985167 7:116232955-116232977 AGGATGTGGTCATTTTCTTTAGG + Intronic
1033650899 7:143342580-143342602 ATGGTGGGGGCTTTGTCTTTAGG + Intronic
1035201733 7:157272062-157272084 AGGACGTGGCCTGTTTCTTTGGG + Intergenic
1036726583 8:11226255-11226277 AGCATGGGGTGTTTTTCTTTTGG - Intergenic
1038432230 8:27509748-27509770 AGAAGGGGTGATTTTTCTGTGGG - Intronic
1039303227 8:36232890-36232912 AGAAGGGGGTCTTTAACTTTTGG - Intergenic
1039912528 8:41836272-41836294 TGGAGGGGTGTTTTTTCTTTGGG - Intronic
1040308144 8:46222914-46222936 AGCAGGGTGACTTTGTCTTTCGG + Intergenic
1044210919 8:89550551-89550573 AGGATTTGGGCTTTTTCCTTGGG + Intergenic
1046344512 8:112904855-112904877 AGGCAGGTGGCTTTTTCCTTTGG - Intronic
1048287967 8:133157043-133157065 AAGACTTGGGCTTTTTCTTTAGG + Intergenic
1049518491 8:143075348-143075370 AGGAGGGAGACTTTTTTCTTAGG - Intergenic
1050198513 9:3114190-3114212 AGTAGGGTGGCTTATTCTTTGGG - Intergenic
1053821524 9:41972558-41972580 ATGAGGGAGGCTTTTACTTTAGG - Intronic
1054609045 9:67214858-67214880 ATGAGGGAGGCTTTTACTTTAGG + Intergenic
1055533814 9:77215697-77215719 AGGAGGGGGACCCTCTCTTTTGG - Intronic
1058041216 9:100303882-100303904 AGAAGGGGGGCTTTTCCTGTGGG - Intronic
1058829861 9:108806704-108806726 AGGAAGGGGACTCTTTCTTGAGG - Intergenic
1059241452 9:112809858-112809880 GAGAGGGAGGCTTTTTTTTTTGG + Intronic
1061620217 9:131807145-131807167 AGGAGAGGGGCTTTTACTCTGGG - Intergenic
1062481953 9:136756658-136756680 CGGAGTGGGGCTGTGTCTTTAGG + Intronic
1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG + Intronic
1186871360 X:13777105-13777127 AAGTGGAGGGCTTTTCCTTTGGG - Intronic
1188450923 X:30307963-30307985 AGGAGGGGAGTTGTTTGTTTAGG - Intronic
1189148170 X:38676287-38676309 AGGAGGGTGGCCTTTATTTTAGG + Intronic
1192630208 X:72771660-72771682 TGGAGTGGGGCTTTCTATTTGGG - Intergenic
1192651502 X:72949144-72949166 TGGAGTGGGGCTTTCTATTTGGG + Intergenic
1200015727 X:153161345-153161367 GGCAAGGGGGTTTTTTCTTTAGG + Intergenic
1200912090 Y:8539690-8539712 AGGGGGGGGGCTTTATGTTCAGG - Intergenic
1200965008 Y:9027716-9027738 AGGAGGGTGGCTTTTTTCTCAGG + Intergenic
1201743726 Y:17349297-17349319 AGGAGGAAGGGTTTTTCTTCAGG + Intergenic