ID: 1186433702

View in Genome Browser
Species Human (GRCh38)
Location X:9525866-9525888
Sequence CACTCCTAATAGTAGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186433702_1186433704 -4 Left 1186433702 X:9525866-9525888 CCCTAATACTACTATTAGGAGTG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1186433704 X:9525885-9525907 AGTGTTAGATGCCTTCGATGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1186433702_1186433706 23 Left 1186433702 X:9525866-9525888 CCCTAATACTACTATTAGGAGTG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1186433706 X:9525912-9525934 CTTTCCTCTTTTTGCCTGAAAGG 0: 1
1: 2
2: 1
3: 52
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186433702 Original CRISPR CACTCCTAATAGTAGTATTA GGG (reversed) Intronic
907517721 1:55003483-55003505 CACTCCTCATAGGAGTACAAAGG + Intronic
911615587 1:100006959-100006981 CATTTCTAATAGTACTCTTAAGG + Intronic
911986746 1:104636419-104636441 CATTCCTAATAGTGATATTTTGG + Intergenic
912930466 1:113954614-113954636 CACTCCAAATAGTTGTTTGATGG + Intronic
915002597 1:152607297-152607319 TTCTCCTAATAGCTGTATTAAGG - Intergenic
918329550 1:183445013-183445035 CACTGACAATTGTAGTATTAAGG + Intergenic
924027687 1:239852821-239852843 TACACTTAATAGTATTATTATGG + Intronic
1069743942 10:70703104-70703126 CTCTCCTTACAGTATTATTAAGG + Intronic
1078612740 11:12835781-12835803 AACTCCAAATAGCAGCATTAAGG - Intronic
1078962232 11:16290331-16290353 CACTTTTAATAGTAATATTTGGG + Intronic
1080935792 11:36862086-36862108 CTCTCTTAATAGAAGAATTATGG - Intergenic
1083058213 11:59843521-59843543 CATTGCTATTAGTAGTAGTAGGG + Intronic
1086782520 11:90925175-90925197 AAGTCATAATAGTAGTATGATGG + Intergenic
1096063716 12:48723395-48723417 CAGACCTAATAATAGAATTATGG + Intergenic
1097579700 12:61439925-61439947 CAGTCCTAATAGAAATATTGTGG + Intergenic
1098492311 12:71095876-71095898 CAATACTAATAGTACTACTAGGG + Intronic
1099671227 12:85695643-85695665 CACTGCTAATCATAGTATAAAGG + Intergenic
1103423360 12:120808816-120808838 CACTACTGAAAGTAGTATTAGGG + Intronic
1104555139 12:129792909-129792931 CCCTCCTGGTAGTAGGATTATGG - Intronic
1105812263 13:24006125-24006147 CTCACCTAATAATAGAATTATGG - Intronic
1109214538 13:59572965-59572987 AATTCATAATAGTAGTTTTAAGG + Intergenic
1110448352 13:75613692-75613714 CAGTTCTAATAGTATTGTTATGG + Intergenic
1111222158 13:85219505-85219527 TACTACTAATAGTATTATAAAGG - Intergenic
1115219329 14:31044186-31044208 AACTCCGGATAGTAGGATTAGGG - Intronic
1120452980 14:84694626-84694648 CATTATTAGTAGTAGTATTATGG - Intergenic
1121907802 14:97763383-97763405 CACTCCAAATACTGGTTTTAGGG - Intronic
1122726805 14:103760954-103760976 CTCTCCAAATATTAGTAATAAGG + Intronic
1127155782 15:56123231-56123253 CACTGCTAATGGTATTATTCAGG + Intronic
1138715361 16:59016095-59016117 AACTCAAAATAGTAATATTAAGG + Intergenic
1140277112 16:73519705-73519727 TACTCCTAACAGGAGTATTGAGG - Intergenic
1146503551 17:33384937-33384959 CACTCCTAATCCTTGCATTATGG - Intronic
1146506397 17:33409464-33409486 AACTCCTAACATTAGTGTTAGGG - Intronic
1158024708 18:52882171-52882193 CAGTTCTAATAGTTGTTTTAGGG + Intronic
1158220918 18:55149897-55149919 CACCCCTAAAAGTAGAACTAGGG + Intergenic
1162045475 19:7997181-7997203 CAATCCTACTCCTAGTATTAAGG + Intronic
1163074508 19:14877381-14877403 CCCTCCAAATAGTCATATTAAGG + Intergenic
925583908 2:5443479-5443501 TACTCCTGAAAATAGTATTAAGG - Intergenic
928084957 2:28340176-28340198 CCCTCCTAGTATTAATATTATGG - Intergenic
937705572 2:124916823-124916845 CACTCCTATAAGTAGTCTCAGGG + Intergenic
944596178 2:201263225-201263247 ATTTCCTAAAAGTAGTATTATGG - Intronic
1170492042 20:16886888-16886910 CACTCCTCACACTAGTATCAGGG + Intergenic
1177514684 21:22134003-22134025 CAGTCATAATGATAGTATTATGG + Intergenic
1178212582 21:30553596-30553618 CCATCCTAATAGAAATATTATGG - Intronic
1178936835 21:36870158-36870180 CACTCCTAATAGCAGTACTGGGG - Intronic
1182565922 22:31199151-31199173 CACTGCTAGTATTATTATTAAGG - Intronic
952664585 3:35888967-35888989 CACTGCTAATTGTAGTATCAAGG + Intergenic
955010712 3:55011899-55011921 CACTCCTATTAGTAAAATTGTGG - Intronic
960095683 3:113687748-113687770 CACTCCTCATAGTTCTTTTAAGG + Intronic
962458064 3:135583508-135583530 CACCCCTAATATTGGTATTATGG + Intergenic
966275214 3:178157158-178157180 TACTCCAAATAGTATCATTAAGG + Intergenic
972944472 4:44237193-44237215 CACTCCTAAAAGGAGCAATATGG + Intronic
974101221 4:57419268-57419290 AACTCCTGAAAGTAGTATTTGGG - Intergenic
975309374 4:72885243-72885265 ACCTCCTAATACTAATATTAGGG - Intergenic
976019117 4:80598317-80598339 CATTTCTAAAAGTAGTATTCAGG - Intronic
977036468 4:91959535-91959557 CACACATAATAGAAGCATTATGG - Intergenic
977889014 4:102285441-102285463 GACTCTTAATAAAAGTATTAAGG - Intronic
983379788 4:166978127-166978149 CAATCCTAATAATACTAATATGG - Intronic
985065880 4:186120976-186120998 CAGTACTAATAGGAATATTAGGG - Intronic
986564988 5:9103897-9103919 ATCTCCTAATAGTACTCTTATGG + Intronic
993112657 5:83677877-83677899 CATTCCAAATAGCAGTTTTATGG - Intronic
993463293 5:88212524-88212546 CACTTATAAAAGTACTATTATGG + Intronic
993686060 5:90939292-90939314 CACTCTTAAAAGCAGTTTTAGGG + Intronic
993819308 5:92594374-92594396 CATTCCATTTAGTAGTATTATGG + Intergenic
993832773 5:92779961-92779983 AACTCCCAATGGTAGTATAAAGG - Intergenic
994242419 5:97440172-97440194 CACTCCAAATAGTCATATTGGGG + Intergenic
995662878 5:114505515-114505537 CATTACTAAGAGTAGTAATAAGG + Intergenic
995941863 5:117595691-117595713 CTCTTCTAAAAGTAGTATGATGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
1007472055 6:42097394-42097416 CACTTCTGAGAGTAGCATTAGGG + Intergenic
1010641255 6:78330821-78330843 AACACCAAATAGTAGCATTAAGG + Intergenic
1011453516 6:87521962-87521984 CTCTCCTATTAGTATTACTAAGG + Intronic
1014898966 6:126940166-126940188 CACTCCTAAGAGTAGAGCTATGG + Intergenic
1015543790 6:134342224-134342246 CTCACTAAATAGTAGTATTACGG + Intergenic
1019818494 7:3219393-3219415 CACTCCAAAGACTAGTATGATGG + Intergenic
1023339582 7:39205566-39205588 CACTGCCAATAGTGATATTATGG - Intronic
1025117606 7:56271811-56271833 CACTCCTAATTATAGGAATATGG + Intergenic
1031356554 7:120793951-120793973 CTCTCCTAACATTAGAATTATGG + Intronic
1035585307 8:768284-768306 CACTTCTAAGAGTAGTGTTGTGG + Intergenic
1043681691 8:83035266-83035288 TACTCCTAATAGAAGCATTCTGG + Intergenic
1046929776 8:119830232-119830254 TAATCCTAATATTAGAATTAAGG - Intronic
1058362514 9:104165774-104165796 CAGTCCTAATAGTGCTATGATGG - Intergenic
1058860311 9:109111580-109111602 CACTCCTAAAAGTAGAATTGGGG - Intronic
1186433702 X:9525866-9525888 CACTCCTAATAGTAGTATTAGGG - Intronic
1186825314 X:13333825-13333847 CACTCTTACTAGTAATGTTAGGG - Intergenic
1186877348 X:13829348-13829370 CACTCCTAACAATAGCCTTATGG - Intronic
1188084738 X:25889571-25889593 CACTCAGAATAGTAGTACTGAGG + Intergenic
1188378798 X:29466314-29466336 ACCGCCTAAAAGTAGTATTATGG - Intronic
1190195897 X:48318158-48318180 CACATCTAATAGTAGCCTTATGG - Intergenic
1198535464 X:137581844-137581866 CACTGTTAATAGCAGTATTTGGG - Intergenic
1199158653 X:144581018-144581040 CACTTTTAATAGAAGTATTTTGG + Intergenic