ID: 1186434297

View in Genome Browser
Species Human (GRCh38)
Location X:9529697-9529719
Sequence CTGTGGAATGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35922
Summary {0: 1, 1: 2, 2: 109, 3: 3076, 4: 32734}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186434291_1186434297 -8 Left 1186434291 X:9529682-9529704 CCTGTAACCCCAGCACTGTGGAA 0: 5
1: 328
2: 17437
3: 317244
4: 260857
Right 1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG 0: 1
1: 2
2: 109
3: 3076
4: 32734
1186434288_1186434297 25 Left 1186434288 X:9529649-9529671 CCTCCATGGCATGGTTGGGCGCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG 0: 1
1: 2
2: 109
3: 3076
4: 32734
1186434289_1186434297 22 Left 1186434289 X:9529652-9529674 CCATGGCATGGTTGGGCGCAGTG 0: 1
1: 0
2: 1
3: 33
4: 251
Right 1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG 0: 1
1: 2
2: 109
3: 3076
4: 32734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186434297 Original CRISPR CTGTGGAATGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr