ID: 1186436053

View in Genome Browser
Species Human (GRCh38)
Location X:9544013-9544035
Sequence CAGGATCTAAGTGGGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 290}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186436053_1186436064 -8 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436064 X:9544028-9544050 AGATCCTGGTAGGGTCTGGCAGG 0: 1
1: 0
2: 1
3: 15
4: 172
1186436053_1186436071 14 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436071 X:9544050-9544072 GGGGAGTTTTGCAAGGAGTTGGG 0: 1
1: 0
2: 1
3: 13
4: 178
1186436053_1186436065 -7 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436065 X:9544029-9544051 GATCCTGGTAGGGTCTGGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 192
1186436053_1186436072 15 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436072 X:9544051-9544073 GGGAGTTTTGCAAGGAGTTGGGG 0: 1
1: 0
2: 4
3: 25
4: 179
1186436053_1186436067 -5 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436067 X:9544031-9544053 TCCTGGTAGGGTCTGGCAGGGGG 0: 1
1: 0
2: 2
3: 35
4: 333
1186436053_1186436069 7 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436069 X:9544043-9544065 CTGGCAGGGGGAGTTTTGCAAGG 0: 1
1: 0
2: 2
3: 17
4: 212
1186436053_1186436070 13 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436070 X:9544049-9544071 GGGGGAGTTTTGCAAGGAGTTGG 0: 1
1: 0
2: 1
3: 13
4: 189
1186436053_1186436066 -6 Left 1186436053 X:9544013-9544035 CCCCTGCCCCCACTTAGATCCTG 0: 1
1: 0
2: 1
3: 26
4: 290
Right 1186436066 X:9544030-9544052 ATCCTGGTAGGGTCTGGCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186436053 Original CRISPR CAGGATCTAAGTGGGGGCAG GGG (reversed) Intronic
900887063 1:5422767-5422789 CAAGATCAAGGTGTGGGCAGGGG - Intergenic
901020396 1:6252414-6252436 CGGGAGCAGAGTGGGGGCAGTGG - Intronic
901125029 1:6923324-6923346 TAGGATCTGAGTGTGGGAAGGGG + Intronic
901247625 1:7745062-7745084 CCGGATGTAATTGGAGGCAGGGG + Intronic
902773216 1:18658251-18658273 CAGGACCTTTGTGGGGGGAGGGG - Intronic
902785256 1:18729004-18729026 CAGGATCTGCCTGGAGGCAGAGG + Intronic
903654869 1:24942987-24943009 TAGGGTCTAGGAGGGGGCAGCGG + Intronic
903743592 1:25572471-25572493 CAAGATCTTGGTTGGGGCAGAGG - Intergenic
905285935 1:36880462-36880484 CAGGGTGTGAGTGGGTGCAGGGG + Intronic
906684768 1:47756244-47756266 CAGGCTCCAAGTGGCAGCAGAGG - Intergenic
906951527 1:50338013-50338035 CAGGCTGTGTGTGGGGGCAGGGG - Intergenic
909482988 1:76145331-76145353 CAGGATTCAAGGAGGGGCAGCGG - Intronic
911598351 1:99822234-99822256 CAGGATCTGTGTGGGGGTAGTGG - Intergenic
911969119 1:104408008-104408030 CAGGATGTGAGTGGGGGGGGTGG - Intergenic
912615720 1:111097692-111097714 CAGAATGTAAGTGGCTGCAGAGG - Intergenic
913107868 1:115631222-115631244 CAGTATCTAAGTGGGGTATGAGG + Intergenic
913233297 1:116759860-116759882 CAGGAACTTGGTGGGGGCAGAGG + Intronic
915227408 1:154421170-154421192 CAGGAGCCAAGGAGGGGCAGGGG + Intronic
915932321 1:160068347-160068369 CAGGCTCTGAGTGGGGGGTGGGG + Intronic
918486553 1:185035012-185035034 CAGCATCTAATGGGGGGAAGAGG - Intergenic
920185701 1:204157957-204157979 GAGGAGCTAAATGGGGGCACTGG - Intronic
920851379 1:209630403-209630425 CAGGCTCTAGCTGGGGACAGTGG + Intronic
921937409 1:220807950-220807972 CAGGGTCTGAGTGCGGGCAGGGG - Intronic
923006933 1:230057765-230057787 CCGGATCTGCCTGGGGGCAGGGG + Intergenic
923291373 1:232549202-232549224 CAGGCTGGAAGTGAGGGCAGTGG - Intronic
924070628 1:240274713-240274735 CAGGACCAGAGTGGGAGCAGTGG + Intronic
1062789284 10:291199-291221 TAGGATCAATATGGGGGCAGAGG - Intronic
1062901562 10:1150671-1150693 CACCATCAAAGCGGGGGCAGGGG - Intergenic
1062972970 10:1662418-1662440 CAGGCTCTGGGTGGGGGAAGGGG - Intronic
1066203282 10:33162158-33162180 CAGTAGCTAACTGGGTGCAGTGG - Intergenic
1066601182 10:37108699-37108721 CATGAGCTAAATGGGAGCAGTGG + Intergenic
1069138082 10:64790034-64790056 CAGGAGGCAAGTGGGGGGAGTGG - Intergenic
1069606047 10:69739392-69739414 CAGAACCAAACTGGGGGCAGAGG + Intergenic
1070325769 10:75387961-75387983 CTGGATCTATGTGGGAGGAGGGG + Intergenic
1070842266 10:79495395-79495417 CAGGAGTGCAGTGGGGGCAGAGG + Intergenic
1071437128 10:85657795-85657817 CAGGTTCTTTGTGGGTGCAGTGG + Intronic
1072231176 10:93415164-93415186 CAGGATCTAACCTGGGGTAGGGG - Intronic
1074496356 10:113983252-113983274 CAGGTTCTAAGCAGAGGCAGGGG + Intergenic
1074506315 10:114073971-114073993 CAGGAAGTGATTGGGGGCAGCGG + Intergenic
1074767024 10:116706984-116707006 CAGGCTCGGAGTGGGGGAAGGGG + Intronic
1075121204 10:119666250-119666272 CAGGCTGGAAGTGGGGGCTGAGG - Intronic
1075363961 10:121866156-121866178 CAGGAGCTATGTGGTGGCAAAGG + Intronic
1076150385 10:128157508-128157530 CTGGAGTTCAGTGGGGGCAGGGG + Intergenic
1076545349 10:131241398-131241420 CAGGAACTAAGTGCAGGCAGAGG + Intronic
1076752084 10:132548317-132548339 CAGGAGGTCAGTGGGGCCAGGGG + Intronic
1077104586 11:836657-836679 CAGGCTCCAGGTGGGGGCTGAGG - Intronic
1077198388 11:1293028-1293050 CAGGGGCTGAGCGGGGGCAGTGG + Intronic
1077865402 11:6217758-6217780 CAGGAACAACGTGGGGGAAGGGG - Exonic
1078542291 11:12222145-12222167 CAGGATCTCAGTGGTGTGAGAGG - Intronic
1079518564 11:21297789-21297811 CAGGATCTATGAGAGGACAGAGG + Intronic
1080213968 11:29819861-29819883 CTGGATCTGAGTTGGGGCTGGGG + Intergenic
1080231646 11:30022823-30022845 CAGGAGCAAACTTGGGGCAGAGG + Intergenic
1080431612 11:32204768-32204790 CAGGATGTTGGAGGGGGCAGAGG + Intergenic
1081658754 11:44874980-44875002 CAGCATTAAATTGGGGGCAGAGG + Intronic
1083001936 11:59300458-59300480 CAGGATGTGAGTAGGGGAAGAGG + Intergenic
1083027958 11:59566155-59566177 CAGGTCCCAAGTGAGGGCAGAGG + Intergenic
1083094093 11:60232467-60232489 CTGGTTCTAACTGGGGGAAGGGG - Intronic
1083339567 11:61950320-61950342 CAGCCTCTAAGAGTGGGCAGGGG + Intronic
1083414011 11:62513585-62513607 CAGGAACTGAGGGAGGGCAGGGG + Intronic
1083514521 11:63244139-63244161 CACGAACTATGTGGGGGCAGAGG - Intronic
1083607074 11:63985475-63985497 CAAGATGTTAGTGGGGGCAGGGG - Intronic
1083642353 11:64152410-64152432 GAGGATCAGGGTGGGGGCAGAGG + Intronic
1084229924 11:67744242-67744264 CAGGATCTAAGGGTGGAAAGGGG - Intergenic
1084874284 11:72119317-72119339 CTGGCCCTAAGTGGGGGCTGGGG + Intronic
1084941473 11:72615511-72615533 CAGGAGCTGAGTGTGGGGAGGGG + Intronic
1085223226 11:74894248-74894270 CAGGATCTACTTGAGGGTAGAGG + Intronic
1085621500 11:78041195-78041217 CAGGATGTAGGTAGGGGCACTGG + Intronic
1085889408 11:80559659-80559681 CATGAGCTAAATGGGAGCAGTGG + Intergenic
1085925064 11:81008497-81008519 GAGGATTAAAGTGGGGGCTGTGG - Intergenic
1086224796 11:84494756-84494778 CAGGATCTAAGTGTTGGATGAGG + Intronic
1086896387 11:92317754-92317776 CAGGATCAAAGTGGGGGCACTGG + Intergenic
1088573048 11:111241820-111241842 CAGGATCCATGAGGAGGCAGAGG - Intergenic
1089633441 11:119797394-119797416 CAGGCTCTAAGTAGGTGGAGGGG + Intergenic
1089772963 11:120816394-120816416 CAGGAGCTGGGTGGGGGCGGGGG + Intronic
1089809661 11:121121324-121121346 CAGGATGTGGGTAGGGGCAGGGG - Intronic
1089813285 11:121149041-121149063 CAGGTTCTAAGTGGGATCTGGGG + Intronic
1091309658 11:134563326-134563348 CTGGCTCTGGGTGGGGGCAGTGG + Intergenic
1092182957 12:6458592-6458614 ATGGATCTAACTGGGGACAGCGG - Intronic
1094192603 12:27712256-27712278 CAGGAGCTAAGTGTGAGTAGAGG + Intronic
1096542958 12:52318473-52318495 CTGCAGCTGAGTGGGGGCAGGGG - Intronic
1096846514 12:54410140-54410162 CAGGTTCTACGCGGGCGCAGTGG - Intronic
1096975518 12:55697389-55697411 AAGGATCAAAGGGAGGGCAGGGG + Intronic
1096994502 12:55830356-55830378 CTGGGTCTACGTGGGGGCGGGGG - Intronic
1097318707 12:58201798-58201820 CTGGATCTTAGTGGCGACAGGGG + Intergenic
1098956021 12:76690583-76690605 CAGGATGGAAGTGGAGGCTGAGG + Intergenic
1099564849 12:84230253-84230275 CAGGACCCAAGTGGGTCCAGAGG + Intergenic
1100881457 12:99022286-99022308 CAGGATCTAAAGGGGGTCACAGG + Intronic
1102711720 12:114933675-114933697 CAGGAACACAGTGGGGGCTGTGG + Intergenic
1102922602 12:116803500-116803522 GTGGATGTAAGTGGGGTCAGCGG - Intronic
1104452047 12:128877748-128877770 AAGCAACTAAGTTGGGGCAGGGG - Intronic
1104640838 12:130465874-130465896 CAGGTGCTGGGTGGGGGCAGAGG - Intronic
1104900827 12:132188801-132188823 CAGGCTGGAGGTGGGGGCAGGGG + Intergenic
1104941887 12:132399157-132399179 CGGCAGCTAAGTGTGGGCAGGGG - Intergenic
1105017419 12:132794175-132794197 CAGTATCCACGTGGGGGCTGAGG - Intronic
1107694248 13:42985056-42985078 AAGGATGAAAGTGGGAGCAGGGG + Intronic
1116204782 14:41849969-41849991 CACCATCTAATTTGGGGCAGTGG - Intronic
1117693763 14:58338003-58338025 CAATATCTAAGTGGCAGCAGGGG - Intronic
1121101690 14:91253977-91253999 CAGGATGGTAGTGGGGGCAGGGG - Intergenic
1121607985 14:95255178-95255200 CAGGATCAAGGTGCCGGCAGGGG - Intronic
1121981956 14:98462129-98462151 CAAGATTTAAATAGGGGCAGAGG - Intergenic
1122263087 14:100534284-100534306 CAGGATCTCAGTGCAGGGAGAGG + Intergenic
1122708004 14:103633509-103633531 GAGAAGCTAGGTGGGGGCAGGGG + Intronic
1123939902 15:25211759-25211781 CTGGATGTATGTGTGGGCAGGGG + Intergenic
1124872052 15:33553060-33553082 CAGGATCTGTGTGGTGGCATAGG + Intronic
1125589257 15:40844356-40844378 CAGGATCGAAGAGGGCGCACGGG - Intronic
1127903358 15:63357750-63357772 CTGGATCTAAGTAGGGGTAATGG - Intronic
1128294828 15:66509335-66509357 CAGGAACTAAGGGAGGGCAAAGG - Intronic
1129288328 15:74543642-74543664 CAGGATCTAAGAGGGGAAATAGG - Intronic
1130453653 15:84081743-84081765 GAGGATTTAAGGGGGAGCAGAGG + Intergenic
1131011305 15:89020434-89020456 CTGGATGTAAGTGGGGGAAGAGG + Intergenic
1131062937 15:89415414-89415436 CAGGCTCTTAGTGAGGGGAGTGG + Intergenic
1134004562 16:10809561-10809583 AAGGAGCTATGTGGGTGCAGGGG + Intronic
1134236684 16:12471800-12471822 CAGGATCTATATCTGGGCAGTGG - Intronic
1135474298 16:22760767-22760789 CAGGATAGAAGTGGGAGAAGAGG - Intergenic
1136168150 16:28470529-28470551 CCGGATCTGAGTTGGGGCGGGGG + Intronic
1136533047 16:30882689-30882711 AAGGTTCTAACTGGGGGCAGTGG + Intronic
1138023429 16:53503951-53503973 CAGCATCCGAGTGGGGGCCGGGG + Intronic
1138379590 16:56590662-56590684 CAGCATCTATGTCGCGGCAGTGG - Intronic
1139267883 16:65656811-65656833 CAGGATTGAAGTGGGAGCTGGGG - Intergenic
1140365573 16:74377861-74377883 CCGGATCTAAGTTGGGGAGGGGG - Exonic
1141178911 16:81739128-81739150 CAGTGTCTGGGTGGGGGCAGGGG + Intronic
1141680565 16:85541443-85541465 CAGGAGCTCAGCTGGGGCAGTGG - Intergenic
1143778622 17:9217148-9217170 CAGGAAGTGAGTGGGGGCAGTGG - Intronic
1144659033 17:17056476-17056498 CAGGACCTGTGTGTGGGCAGAGG + Intronic
1144804564 17:17956137-17956159 CAGGATGTGGGTGGGGCCAGAGG - Intronic
1144831843 17:18136251-18136273 CAGAGTCAGAGTGGGGGCAGGGG + Intronic
1147169677 17:38610606-38610628 CAGGGCCTAAGTGGGGAGAGGGG + Intergenic
1147854444 17:43468228-43468250 CAAAATGTAAGTGGGGGCGGAGG - Intergenic
1149450531 17:56746571-56746593 CAAAATCAAAGTGTGGGCAGGGG - Intergenic
1149451087 17:56750519-56750541 CTGCATCAAAGTGGCGGCAGGGG - Intergenic
1149544919 17:57496372-57496394 AAGGACCTAAGTGGGGAGAGGGG - Intronic
1150621889 17:66814011-66814033 CAGCACCTATCTGGGGGCAGGGG - Intergenic
1151099959 17:71545375-71545397 CAGGATCTCTGAGGGAGCAGAGG + Intergenic
1152265497 17:79291985-79292007 CAGCATCTAAGTAGGGGTGGAGG - Intronic
1152533560 17:80937144-80937166 CAGGAGCTAAGCGGGTGGAGAGG + Intronic
1153780771 18:8493406-8493428 GAGGATCTGAGTGGGGTAAGGGG - Intergenic
1154301695 18:13199285-13199307 CAGGATGCAAGTGGGGGCGGGGG - Intergenic
1156486796 18:37471544-37471566 CAGGATCTAGGTGGATGGAGGGG - Intronic
1158371368 18:56809078-56809100 CAGGAGGAAAATGGGGGCAGAGG - Intronic
1158476469 18:57784316-57784338 CAGGATCTGAGTGGGTGCTCTGG + Intronic
1160851153 19:1193282-1193304 CAGGTTCTAGGTGGGGGCCTGGG - Intronic
1161147200 19:2685992-2686014 CAGGATATCGGTGGGGGCTGAGG - Intronic
1161366686 19:3883967-3883989 GAGGAGCTCACTGGGGGCAGGGG - Intronic
1161609155 19:5231419-5231441 CAGGATCTGAGTGGTGGTCGGGG + Exonic
1161962320 19:7529573-7529595 GAGGATCTGGGTTGGGGCAGAGG - Exonic
1162373032 19:10290232-10290254 CAGGCTCGAGGTGGGGGCAGAGG - Intronic
1164501877 19:28827201-28827223 GAGATGCTAAGTGGGGGCAGAGG - Intergenic
1166347978 19:42178132-42178154 CAGGAACAGAGTGGGGGGAGAGG + Intronic
1166695058 19:44847376-44847398 CTGGATTTAATTGTGGGCAGGGG + Intronic
1166715186 19:44962443-44962465 CAGGATCCAGCTGTGGGCAGGGG + Intronic
1167608240 19:50493121-50493143 CAGGAACAGAGTGGGAGCAGGGG + Intergenic
1167724618 19:51201617-51201639 GAGGCCCTAAGTGGGGGCAGGGG + Intergenic
1168053276 19:53845896-53845918 CAGGAACTAGGCGGGCGCAGTGG - Intergenic
925346340 2:3174716-3174738 GAGGAACTTTGTGGGGGCAGTGG + Intergenic
925988106 2:9232059-9232081 CATGACCTCAGTGGGAGCAGAGG - Intronic
926121557 2:10243770-10243792 CAGGGTTTGAGTGGGGGGAGAGG - Intergenic
926697418 2:15780453-15780475 CAGGAGCTCAGTGGGCCCAGGGG - Intergenic
927381964 2:22489596-22489618 CAGGATCTACTTGAGGGTAGAGG + Intergenic
927567102 2:24123173-24123195 CAGGACCCAAGGCGGGGCAGGGG + Exonic
927908599 2:26880425-26880447 CAGGATCCAAGTGTGGTCATAGG - Intronic
930047569 2:47186628-47186650 AAGGATCAGAGTGGGGGCTGTGG - Intergenic
931244714 2:60482415-60482437 CAGGAACTAAGCAGTGGCAGTGG - Intronic
931922918 2:67040249-67040271 CAGGATTGAAGGAGGGGCAGGGG - Intergenic
933317090 2:80727913-80727935 CAGGCCCTAAGTGGGTCCAGAGG - Intergenic
933781851 2:85807931-85807953 CAGGCCCTGGGTGGGGGCAGTGG + Intergenic
934578612 2:95419817-95419839 GAGGAACAGAGTGGGGGCAGGGG + Intergenic
934724644 2:96607899-96607921 CTGGATCAATGTGGGGGAAGGGG + Intronic
935038675 2:99404374-99404396 CAGGTCCTAAGTTGGAGCAGGGG + Intronic
935197308 2:100824991-100825013 CAGGATGGAAATGGGAGCAGTGG + Intronic
935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG + Intergenic
936043238 2:109165732-109165754 AAGGATCTGAGTGGGGAGAGTGG - Intronic
941060527 2:160842262-160842284 CAGAATTTAAGTGGGGTCACAGG + Intergenic
941175325 2:162191381-162191403 CAGAATCTCACAGGGGGCAGTGG + Intronic
946023723 2:216659396-216659418 CAAGATCTGGGTGGGTGCAGAGG - Intronic
946278496 2:218648857-218648879 CAAAATCACAGTGGGGGCAGTGG + Exonic
947385844 2:229589305-229589327 TAAGATCTAAGTGTGGGCTGTGG - Intronic
948237130 2:236399735-236399757 CAGGATCAAACTCGGGGCATGGG - Intronic
948358781 2:237403117-237403139 CAGGAGCTAAGTGGGTGCAAAGG + Intronic
948402648 2:237694714-237694736 CAGGATCTGAGTGGGAGCCTGGG + Intronic
1168904449 20:1392396-1392418 AGGGATGGAAGTGGGGGCAGGGG + Intronic
1169320043 20:4625164-4625186 CTGGAGCTTAGTGGGGGGAGGGG - Intergenic
1170329037 20:15188255-15188277 CAGCATTGAACTGGGGGCAGAGG - Intronic
1172642660 20:36450208-36450230 CAGGGTCTGGGTGGGCGCAGTGG + Intronic
1174406468 20:50306308-50306330 CAGGCCCTGAGTGGGGGCTGTGG + Intergenic
1175671920 20:60910646-60910668 CAGGATCAAAGTGTAGGCAGGGG + Intergenic
1176243286 20:64084852-64084874 CAGGAGCTAAGGAGGGGCGGGGG - Intronic
1179982200 21:44901413-44901435 CAGGCGCTGTGTGGGGGCAGGGG - Intronic
1181116034 22:20633013-20633035 CAGGTTCTCAGTGGGGGATGGGG + Intergenic
1181360283 22:22328933-22328955 CAGGATGTAGGAGGGGGAAGTGG - Intergenic
1182872459 22:33660506-33660528 TAGGGGCTAACTGGGGGCAGAGG - Intronic
1183060787 22:35335255-35335277 AAGGAGCTGAGTGGGGTCAGTGG - Intronic
1183273181 22:36874627-36874649 CAGGTTGAAGGTGGGGGCAGAGG + Intronic
1183525427 22:38319707-38319729 CAGGATCTTAACTGGGGCAGGGG - Intronic
1183831237 22:40419238-40419260 CAGGATAGAGGTGGCGGCAGGGG + Exonic
1184411343 22:44328186-44328208 CAGGAACCATGAGGGGGCAGGGG - Intergenic
949440156 3:4071603-4071625 CTGGAGCTTAGTGGGGGGAGGGG + Intronic
949846097 3:8372203-8372225 CAGGAGCTTGGTGGGGGGAGGGG + Intergenic
950133916 3:10567154-10567176 CACAATCTAACTGGGGCCAGAGG + Intronic
951202003 3:19885744-19885766 CAGGAACTGAGTGTGGGGAGAGG - Intronic
952960416 3:38585960-38585982 CGGGAACTCAGTGGGGGCACTGG - Exonic
953033384 3:39192044-39192066 CAGGAGAGAGGTGGGGGCAGGGG - Intronic
953123964 3:40073453-40073475 CAGGAACTAGGTGGGGACAAAGG - Intronic
953522861 3:43659486-43659508 CAGGAGCTTGGTGGGGGGAGGGG + Intronic
953927442 3:46989605-46989627 GTGGAGCCAAGTGGGGGCAGGGG - Intronic
954009579 3:47623908-47623930 CAGGAACTTGGTGGGGGGAGCGG + Intronic
954053318 3:48000945-48000967 CAGCATGTAAGTGGGAGGAGAGG - Intronic
955917948 3:63925370-63925392 CAGGAGGTAAGTGGGGGTGGGGG + Intronic
961094397 3:124142130-124142152 CAGGATCTCAGTAAGAGCAGAGG - Intronic
961158444 3:124700836-124700858 CTGGATTCAGGTGGGGGCAGAGG - Intronic
961657416 3:128450890-128450912 CAAGATCTAAAAGGGAGCAGGGG - Intergenic
962388652 3:134953539-134953561 CAGGGTCTAAGTGGGGACCAAGG + Intronic
963736264 3:149020818-149020840 GAGGATCTAAGTAGGTGCTGTGG + Intronic
964213170 3:154250373-154250395 CAGCATCTAAGAGGGGGGGGTGG + Intronic
965630161 3:170724888-170724910 GAGGATGTAAGTGGAGGCTGAGG - Intronic
965692356 3:171371212-171371234 CAGGATTTAAATGGGGGAAGGGG + Intronic
967714358 3:192745306-192745328 CAGGATTTCTGTGGGAGCAGAGG - Intronic
968420250 4:477949-477971 CAGAAACTAAGTGGGGACAAAGG + Intronic
969335713 4:6508651-6508673 CAGGATCTGAGTTGGGCGAGTGG + Intronic
969374526 4:6754405-6754427 CAGGCTCCAAGTGGGAGCTGGGG + Intergenic
970447974 4:16139847-16139869 CAGGCCCCAGGTGGGGGCAGGGG + Intergenic
970746195 4:19298805-19298827 CATCATCTCAGTGAGGGCAGAGG - Intergenic
971375590 4:26053356-26053378 CAGGATCCAAGCAGGGGAAGTGG + Intergenic
972211433 4:36842724-36842746 CAGGATGTTGGTGGGGGCAGAGG - Intergenic
974655137 4:64809157-64809179 CAGGATTTAAGTCTGTGCAGAGG + Intergenic
976370815 4:84286231-84286253 CTGGATCTTGGTGGGGGAAGGGG + Intergenic
976765428 4:88592973-88592995 CAGAATTTAAATAGGGGCAGGGG - Intronic
978263782 4:106796702-106796724 CAGGATACAAGTGGGGGAAAGGG + Intergenic
979299522 4:119070438-119070460 CTTCATCCAAGTGGGGGCAGGGG - Intergenic
979407919 4:120337999-120338021 CAGAACCTGAGTGGGGGAAGAGG - Intergenic
980002109 4:127501723-127501745 CAGGATCTCCGTTGGGGCTGGGG + Intergenic
980888123 4:138785467-138785489 CACGAGCTTAGTGGGGGGAGGGG - Intergenic
982658181 4:158174757-158174779 CAGGCTCAAAGTGGGGTGAGCGG - Intergenic
983261401 4:165460820-165460842 CAGACTCTATGTGGGGGCACAGG + Intronic
985755019 5:1708736-1708758 CGGGCTCCAAGTGGGGGCAGGGG - Intergenic
986743150 5:10721221-10721243 CAGGAACTAAGAGGTGGAAGTGG + Intronic
986763162 5:10898369-10898391 TAGAGTCTCAGTGGGGGCAGAGG + Intergenic
989097592 5:37795521-37795543 CAGGGTCCAAGTGGTGGCACGGG + Intergenic
989239564 5:39188501-39188523 AAGGATTAGAGTGGGGGCAGTGG - Intronic
989539341 5:42600309-42600331 AAGGATGTAAGAGTGGGCAGAGG + Intronic
989825344 5:45848100-45848122 CTGGAGCTAGGTGGGGGGAGGGG + Intergenic
992980252 5:82162818-82162840 CAGGATTTAAGCAGGGGCGGGGG + Intronic
994871239 5:105352086-105352108 CAGGAGCAGAGTGGGGGCCGGGG + Intergenic
995790649 5:115883042-115883064 CTGGAGCTTAGTCGGGGCAGAGG - Intronic
997962535 5:138333354-138333376 CAGGATCTTGGTGGTGGTAGTGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998133393 5:139662218-139662240 CAAAATCTAAGTGGGGGCACTGG - Intronic
998141335 5:139701285-139701307 AAGGATGGAAGTTGGGGCAGTGG + Intergenic
998510834 5:142712727-142712749 CAGGAAGGAAGTGGGGGCAGGGG + Intergenic
999449254 5:151666042-151666064 CAGGCTCCAAGGGGTGGCAGGGG - Intronic
1002461499 5:179376011-179376033 AAGGATCTCAGTGGGGGAGGGGG + Intergenic
1002909752 6:1480684-1480706 CAAGATCAAGGTGTGGGCAGGGG + Intergenic
1003556904 6:7148096-7148118 CAGGGTATACGTGGGGGGAGAGG + Intronic
1004093563 6:12530113-12530135 CAGGGTGTAAGTGGGAGGAGAGG - Intergenic
1004133072 6:12939703-12939725 CAGGAGCTAGGGGGGGCCAGAGG + Intronic
1005714781 6:28536326-28536348 CAGATTCTGAGTGGGAGCAGAGG - Intergenic
1005870622 6:29972103-29972125 CTGGATCTGGCTGGGGGCAGGGG - Intergenic
1007067911 6:39011288-39011310 CAGGCTTTATGAGGGGGCAGTGG + Intronic
1007135079 6:39512936-39512958 GAGGAGCTAATTGGAGGCAGGGG - Intronic
1008241182 6:49113873-49113895 CAAGATGTAAGTGTGGACAGTGG - Intergenic
1008523102 6:52381230-52381252 CAGGAACTAGGTGGGGGAAGAGG + Intronic
1008527413 6:52420377-52420399 CAGGACCTAGGTGGCGGCGGTGG + Exonic
1009918866 6:70031200-70031222 AATGATCTGTGTGGGGGCAGAGG - Intronic
1011200716 6:84832934-84832956 CAGGACTAAAGTGGAGGCAGTGG - Intergenic
1013296347 6:108761398-108761420 CAGCATCTAAGTGGGTACAGAGG - Intergenic
1016765234 6:147785361-147785383 GGGGATCTGATTGGGGGCAGTGG - Intergenic
1016881673 6:148917688-148917710 CTGGGGCTATGTGGGGGCAGGGG + Intronic
1018035216 6:159875812-159875834 GAGGATCTAAGTTGGGGATGGGG + Intergenic
1018087820 6:160320198-160320220 TAGGATCTCAGTGGGTGCAATGG + Intergenic
1019176394 6:170161348-170161370 CAGGCTCCAAGGGGAGGCAGAGG + Intergenic
1019325680 7:437039-437061 CAGGCTCTGAGTGGGTGCAGTGG - Intergenic
1019727620 7:2611731-2611753 CAGAAGCTAAGTGGAGACAGGGG - Exonic
1020275885 7:6624120-6624142 CAGGAAGTGACTGGGGGCAGAGG - Exonic
1022063783 7:26828943-26828965 CTGGAACCCAGTGGGGGCAGAGG + Intronic
1022538462 7:31113365-31113387 CAGGTTCTAAGTGAGGACACTGG + Intergenic
1022909392 7:34885498-34885520 CAGGAGATAAGTGGTTGCAGTGG - Intergenic
1023315910 7:38936190-38936212 CAGGATCTAGCTGGGTGCAGTGG - Intergenic
1023584486 7:41715194-41715216 CAGGGTCCAAGTGGGGACCGGGG - Intergenic
1023736166 7:43237838-43237860 CAGGCTCCAAGTGGGGGCGGCGG - Intronic
1027052962 7:75031227-75031249 CACCATCGTAGTGGGGGCAGGGG + Intronic
1030682733 7:112450450-112450472 CGGGAGCTAAGGCGGGGCAGGGG - Exonic
1031057693 7:117011338-117011360 CAGGATAGAAGAGGGGACAGTGG + Intronic
1032012736 7:128357521-128357543 CAGGATGTGATTGGGGGTAGGGG - Intronic
1032868997 7:135960450-135960472 CAGGTTTTAAGTGTGGTCAGAGG + Intronic
1032934482 7:136713105-136713127 TAGGATAGAAGTGGGGGCAATGG - Intergenic
1033281862 7:140011712-140011734 CAGAATTTCAGTGGGGGAAGAGG + Intronic
1035959198 8:4118142-4118164 CAGACTCTCAGTGGGAGCAGAGG + Intronic
1042717833 8:71794085-71794107 AAGAAGATAAGTGGGGGCAGAGG + Intergenic
1042770425 8:72374781-72374803 CAGTACCTATGTGGGGGAAGAGG - Intergenic
1045010750 8:97956657-97956679 CAGGATCAAATTGAGGGCTGGGG - Intronic
1046323905 8:112615177-112615199 CATGATCTAAGTGGAAGGAGAGG - Intronic
1048420940 8:134277745-134277767 CAGAATCTAAGGGATGGCAGTGG + Intergenic
1048466107 8:134665850-134665872 CAGGACCTCAGGGGAGGCAGAGG - Intronic
1049232259 8:141490521-141490543 CAGGCTCTAAGTGGGAGTGGAGG - Intergenic
1049762573 8:144337836-144337858 CAGGCCCTAATTGGGGACAGAGG - Intergenic
1053086352 9:35226293-35226315 CAGGTTCTTTCTGGGGGCAGGGG - Intronic
1053283843 9:36838177-36838199 CAGGTTCTGGGTGGGGGCGGGGG + Exonic
1055453636 9:76453512-76453534 CAGGTACTCAGTGGGGGAAGAGG + Intronic
1056881406 9:90397090-90397112 AAGGATCAAAGTGGGGGTGGGGG + Intergenic
1056974021 9:91234103-91234125 CGGGATTTTAATGGGGGCAGTGG - Intronic
1057854341 9:98591074-98591096 CAGGATAGAAGTGGGAGCAATGG + Intronic
1057892465 9:98879898-98879920 CAGGGTCTCTGTGGGGTCAGAGG + Intergenic
1058559041 9:106204058-106204080 CTGGAGCTTAGTGGGGGGAGGGG - Intergenic
1058912833 9:109536679-109536701 GAAGAGCTAAGTGGGGGTAGGGG + Intergenic
1060050481 9:120375057-120375079 CAGGATCTACGTGAGGCCTGTGG + Intergenic
1060775143 9:126367473-126367495 CAGAAACGAAGTAGGGGCAGAGG - Intronic
1061245881 9:129401157-129401179 CAGGATCATCGTGGGGGCCGGGG - Intergenic
1185822294 X:3217309-3217331 CAAGATCAAGGTGTGGGCAGGGG + Intergenic
1186436053 X:9544013-9544035 CAGGATCTAAGTGGGGGCAGGGG - Intronic
1187873364 X:23782997-23783019 GAGGACAAAAGTGGGGGCAGCGG - Intergenic
1188514534 X:30970969-30970991 CAGGATCTAAGTGGCGTTTGGGG - Intronic
1190275652 X:48897575-48897597 CAGGAACCGAGTGGGGGTAGCGG + Intronic
1192524127 X:71827024-71827046 CAGCATCTGAGTGGGGGAAGAGG + Intergenic
1192576593 X:72247655-72247677 CAGGAGGGAAGTGGGGGCAAAGG + Intronic
1192601121 X:72465158-72465180 CTGGTTCTCAGTGGGGGCTGGGG + Intronic
1198566634 X:137912013-137912035 GAGGACCTAAATGGTGGCAGAGG - Intergenic
1199999483 X:153050646-153050668 CAGGATGTCAGTAGTGGCAGGGG + Intergenic
1201234991 Y:11900539-11900561 CAAGATCAAGGTGTGGGCAGGGG + Intergenic
1201984461 Y:19950483-19950505 AAGGTTCTAACTGAGGGCAGAGG - Intergenic