ID: 1186436081

View in Genome Browser
Species Human (GRCh38)
Location X:9544154-9544176
Sequence CATAATAATTAGTAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186436081_1186436087 29 Left 1186436081 X:9544154-9544176 CCAAACTCCTACTAATTATTATG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1186436087 X:9544206-9544228 ACAGGCATTGCTATCCCATGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1186436081_1186436084 11 Left 1186436081 X:9544154-9544176 CCAAACTCCTACTAATTATTATG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1186436084 X:9544188-9544210 GTCAAGATCAGGAGAAGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1186436081_1186436083 0 Left 1186436081 X:9544154-9544176 CCAAACTCCTACTAATTATTATG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1186436083 X:9544177-9544199 TGTTTGCTCAAGTCAAGATCAGG 0: 1
1: 0
2: 2
3: 10
4: 107
1186436081_1186436085 27 Left 1186436081 X:9544154-9544176 CCAAACTCCTACTAATTATTATG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1186436085 X:9544204-9544226 GTACAGGCATTGCTATCCCATGG 0: 1
1: 0
2: 0
3: 8
4: 90
1186436081_1186436086 28 Left 1186436081 X:9544154-9544176 CCAAACTCCTACTAATTATTATG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1186436086 X:9544205-9544227 TACAGGCATTGCTATCCCATGGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186436081 Original CRISPR CATAATAATTAGTAGGAGTT TGG (reversed) Intronic
905468039 1:38170624-38170646 AATATTGATTATTAGGAGTTAGG - Intergenic
905591047 1:39163918-39163940 CCTAGTAATTTGTAGGATTTCGG - Intronic
905854177 1:41296618-41296640 CCTAATATTTTGTTGGAGTTGGG + Intergenic
909581271 1:77238450-77238472 TATAATTATTATTAGGAGTCAGG + Intergenic
911385348 1:97168487-97168509 ATTAATATTTAGTAAGAGTTGGG + Intronic
912654645 1:111475332-111475354 ATTAATGAGTAGTAGGAGTTTGG + Intronic
912916502 1:113820470-113820492 CATAATAATTATTATTATTTAGG + Intronic
913062986 1:115224981-115225003 CTTAAGAATGAGGAGGAGTTGGG - Intergenic
915999330 1:160599722-160599744 CATTATAATCAGGAGGAGGTGGG + Intergenic
919864796 1:201772730-201772752 CATTATAAATACTAGGAGCTTGG + Intronic
1063647954 10:7904729-7904751 CATGATATTTAGTAGAAATTTGG + Intronic
1066624461 10:37392166-37392188 AATAATAATTATTTGGAGTGGGG - Intergenic
1067958800 10:50824232-50824254 CATGATAATTAGTAGGATCCGGG + Intronic
1069303913 10:66944488-66944510 CATCAACATTAATAGGAGTTAGG - Intronic
1070377867 10:75851757-75851779 CAAAATAATTAATAGGAGCATGG - Intronic
1074144318 10:110702944-110702966 CTTAATAAATATTAAGAGTTTGG + Intronic
1075602444 10:123780238-123780260 GATAATAATTATTAGGATCTAGG + Exonic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078785455 11:14487075-14487097 AATAATAAGTAGTAGTACTTGGG - Intronic
1079024188 11:16932956-16932978 TATAATACCTAGTAGGAATTTGG + Intronic
1079230171 11:18642946-18642968 AATAAAAATTAGTTTGAGTTAGG + Intergenic
1079310653 11:19362833-19362855 CATAGTACTTAGTAGGTGTCAGG - Intronic
1079390806 11:20020492-20020514 GATAATAATTAGTAGGGATAAGG - Intronic
1080957684 11:37119581-37119603 CCAACAAATTAGTAGGAGTTAGG + Intergenic
1087678560 11:101191165-101191187 CTGAAAAATTAGTAAGAGTTAGG + Intergenic
1088500969 11:110481826-110481848 CCTAAGAATTAGTAGAAATTTGG - Intergenic
1088775433 11:113078043-113078065 CATAACAATTAGTACGATCTTGG + Intronic
1090376984 11:126297158-126297180 CATCATAATCAGTAGGGGTGGGG - Intronic
1092667770 12:10823667-10823689 CTTAATAATGTGTAGGAGTATGG - Intergenic
1092889433 12:12955044-12955066 ATTAATCATTAATAGGAGTTAGG - Intergenic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1097379026 12:58873356-58873378 CATAACATTTCGTAGAAGTTGGG + Intronic
1098206558 12:68116745-68116767 TATAAACATTAATAGGAGTTTGG - Intergenic
1098634721 12:72768061-72768083 AATAAGAAGTAGTAGGATTTGGG - Intergenic
1099889643 12:88575219-88575241 GATAATAAGTAGTAGTAATTTGG - Intronic
1100044573 12:90363651-90363673 AATAATAATTTATATGAGTTGGG + Intergenic
1100839412 12:98597036-98597058 CAAAAAAAGTAGTAGGAGTTGGG + Intronic
1100893422 12:99151917-99151939 CATCATAGTTAATAGGAGTGTGG + Intronic
1100899133 12:99218268-99218290 CATAATAATTCAGAGGACTTAGG - Intronic
1103990471 12:124795704-124795726 CAAAATGATCAGGAGGAGTTGGG - Intronic
1106916828 13:34524720-34524742 CAGAAGAGTTTGTAGGAGTTGGG - Intergenic
1109578989 13:64300997-64301019 CATAATAATTAAAAGAACTTAGG + Intergenic
1111398077 13:87694159-87694181 CATAATTATTACTATGAGCTTGG + Exonic
1111408323 13:87839983-87840005 TATAAAAATTAGTTTGAGTTAGG + Intergenic
1112990797 13:105511751-105511773 AATAAAAAATAGTAGAAGTTTGG + Intergenic
1116392944 14:44415516-44415538 CAAAATAATATGTAGAAGTTCGG + Intergenic
1116651362 14:47596848-47596870 CTTACTAATTTTTAGGAGTTAGG - Intronic
1119603736 14:75996421-75996443 AATAATAGTTAGCAGGTGTTGGG - Intronic
1119706482 14:76785915-76785937 GAGAATTATTGGTAGGAGTTGGG - Intergenic
1120245394 14:81999757-81999779 CAAAATAATTAGTTGCAGCTCGG - Intergenic
1123635138 15:22298575-22298597 AATAATACGTAGTAGGAGGTAGG + Intergenic
1124426471 15:29567435-29567457 CCTAATCGTTAGCAGGAGTTTGG + Intronic
1125519326 15:40339407-40339429 CAGAATAGTTAGTAGGAGAGGGG + Intronic
1126615843 15:50578907-50578929 CATAAATATTATTAGCAGTTTGG + Intronic
1126823242 15:52525807-52525829 GATATTTATTAGTAGAAGTTAGG - Intronic
1127407293 15:58664156-58664178 CTTAAGAATAAGTAGGAGTTAGG - Intronic
1127551062 15:60038793-60038815 TATCATAATTAGTATGAGTAAGG - Intronic
1128694000 15:69746936-69746958 CATAATAAACAGTAGGATTCTGG + Intergenic
1138339882 16:56281626-56281648 CATAATAATGAGCTGGAGTGAGG - Intronic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1143939123 17:10520411-10520433 CATAATGATGGGTATGAGTTTGG - Intergenic
1146522935 17:33540372-33540394 CAGCATAGGTAGTAGGAGTTAGG + Intronic
1146525712 17:33565368-33565390 CATAATAGTTAGTAGGTGGCAGG + Intronic
1146987499 17:37234400-37234422 AATAAGAATTAGTAGGAAGTAGG - Intronic
1147435731 17:40413501-40413523 CATCATAGTTACTAGAAGTTAGG + Exonic
1149201616 17:54192906-54192928 TCTAATAAATAGTAGGGGTTTGG + Intergenic
1150063969 17:62093081-62093103 AATAATACTTAAGAGGAGTTAGG - Intergenic
1150924517 17:69518531-69518553 CATATTATTGAGTAGGTGTTTGG + Intronic
1153511265 18:5855536-5855558 AATACAAATTAGTAGAAGTTTGG + Intergenic
1157983373 18:52408875-52408897 CAAAATGATTTGTGGGAGTTTGG + Intronic
1158360642 18:56668608-56668630 TATACTAATTATTAGGAGTTTGG + Intronic
1159805340 18:72950845-72950867 CATAAAAATAAGTAAGAATTTGG + Intergenic
1160654557 19:257714-257736 CATAATATATAGTAAGATTTGGG - Intergenic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1168060377 19:53888824-53888846 AATAATAACTTGTGGGAGTTGGG + Intronic
925406623 2:3609823-3609845 CAAAAAAATTAGCAGGGGTTGGG - Intronic
926787952 2:16537042-16537064 CATAGTATTTACCAGGAGTTAGG - Intergenic
927764774 2:25796486-25796508 CAGAATAATTAGCAGTAATTAGG + Intronic
928420765 2:31136822-31136844 CATAAGTAGTTGTAGGAGTTGGG - Intronic
928586572 2:32765023-32765045 CATCAACATTAATAGGAGTTTGG - Intronic
931372322 2:61675216-61675238 CATAAAATATAGTAGGTGTTTGG + Intergenic
934077639 2:88441458-88441480 AATAAGAGTTAGTAGGTGTTTGG + Intergenic
936894391 2:117409991-117410013 CATAATAACTTGTTGAAGTTTGG - Intergenic
940102693 2:150060036-150060058 CATTATAATTAGTGGCATTTGGG - Intergenic
940278582 2:151965681-151965703 CTCAATCATTAGTAAGAGTTAGG + Intronic
942964175 2:181869915-181869937 CAAAATAATTAGAAGAATTTTGG + Intergenic
943665261 2:190602443-190602465 CATTAAAATTAGTAGATGTTGGG - Intergenic
945341112 2:208656091-208656113 CAAAGGAATTAGTAGAAGTTAGG + Intronic
1170227488 20:14007910-14007932 AATAATAATGAGGATGAGTTAGG + Intronic
1170674160 20:18463663-18463685 CATAATTCTTAGGAGAAGTTGGG - Intronic
1170829660 20:19829305-19829327 CTTATTAATTTGTAGGACTTTGG + Intergenic
1172579180 20:36033319-36033341 CATAAAATTTAAAAGGAGTTTGG - Intergenic
1174730803 20:52915029-52915051 CAAAAAAATTGGCAGGAGTTGGG + Intergenic
1174971947 20:55286168-55286190 GATAAAAAGTAGTAGGAGATGGG + Intergenic
1176972453 21:15282260-15282282 CAGAATAATTTGAAGGAATTAGG - Intergenic
1177115904 21:17086827-17086849 CATAAGAATAAGTGGAAGTTAGG + Intergenic
1185394287 22:50578787-50578809 AATAATAAATACTAGGACTTGGG - Intronic
949420657 3:3862499-3862521 CATAAGAATTTATAGAAGTTAGG + Intronic
951634847 3:24762162-24762184 CAAAATAAATTTTAGGAGTTTGG - Intergenic
954840871 3:53510178-53510200 CATTGTAATTAGAAGGAGTTGGG - Intronic
956319292 3:67978280-67978302 CATAAATATTAGAGGGAGTTTGG + Intergenic
957158066 3:76571583-76571605 CAATATAATTCATAGGAGTTAGG + Intronic
957441998 3:80260660-80260682 TATAATATTCAGTGGGAGTTTGG - Intergenic
958934165 3:100239491-100239513 CATAATAATTAGTAGCTGGCAGG + Intergenic
959455255 3:106552073-106552095 CATTATAATTATTGGGAGTGGGG - Intergenic
960270952 3:115674039-115674061 CATCATGATTAGCAGGAGCTGGG + Intronic
960670603 3:120152264-120152286 AAAAATAATTAGTAGGGTTTCGG + Intergenic
961026510 3:123563059-123563081 CATAGTACCTAGCAGGAGTTTGG - Intronic
961861923 3:129923657-129923679 CTTAAAAATTAGAATGAGTTTGG + Intergenic
962143512 3:132816113-132816135 CAAAATAATTAGTAGAAAATGGG - Intergenic
962714075 3:138112295-138112317 TATCATAATTATTAAGAGTTTGG - Intronic
962959847 3:140300616-140300638 AAGAATAATAAGTAGGAGCTAGG + Intronic
965655439 3:170978428-170978450 CATTATAATTAATAGTACTTGGG - Intergenic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
966722012 3:183072936-183072958 TATAATAATTTGTCTGAGTTTGG + Intronic
967948120 3:194820000-194820022 CATAAAAATTAGTGGGATATGGG + Intergenic
968259130 3:197305276-197305298 CATAATAATTTGGAGAAGCTTGG + Intergenic
972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG + Intronic
974367046 4:60963677-60963699 CATAAAAAATAGTAGGATTTAGG + Intergenic
975302749 4:72810121-72810143 GATAATAATTATTAGCATTTTGG + Intergenic
977943753 4:102886542-102886564 CATAATAATAATTAACAGTTTGG - Intronic
978882191 4:113718930-113718952 CTTAATATTTAGTAGTATTTAGG - Intronic
979186532 4:117802463-117802485 CATAGTAATTAGCATGTGTTAGG + Intergenic
980311113 4:131129871-131129893 CACAAGAATTAGTAGGAGTATGG - Intergenic
980427746 4:132648218-132648240 CATGATCATCAGTAGGTGTTAGG + Intergenic
981957830 4:150500929-150500951 CTTAATATTTAGTAGGAGGCAGG - Intronic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
987606586 5:20143789-20143811 CACAATAATTTGTAAGATTTTGG + Intronic
988113509 5:26853511-26853533 TATACTAATTGGTAGGAGTTTGG - Intergenic
990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG + Exonic
991220736 5:64212795-64212817 AATTATAAGTAGTAGGACTTTGG + Intronic
991673345 5:69069139-69069161 CATATTAATTTGAAGGTGTTGGG - Intergenic
992991878 5:82292186-82292208 CATAATAATTAGTAGCCAGTAGG - Intronic
994062829 5:95499957-95499979 CATAATAATTCTTATAAGTTTGG - Intronic
994812370 5:104537876-104537898 CATTATAATTTGTATAAGTTTGG - Intergenic
995303381 5:110612514-110612536 CATCATAATTAGTAGGATCAAGG + Intronic
995904612 5:117108446-117108468 CATAATAGTTAGGAGGATATTGG + Intergenic
996137578 5:119863403-119863425 CATAATAATAAGGAGGATGTTGG + Intergenic
999824472 5:155260817-155260839 CATAGTAGTTAGTAGCACTTGGG - Intergenic
1001744228 5:174078635-174078657 CATATTAGTTATTAGGAGGTGGG + Intronic
1004132344 6:12932481-12932503 TATTATAAATAGAAGGAGTTTGG - Intronic
1004599719 6:17136882-17136904 TATAAAAATTAGTAGCATTTTGG + Intergenic
1007296613 6:40827176-40827198 CATCATAATTAGGAGAAATTAGG - Intergenic
1010116599 6:72318917-72318939 CATCATAATTACTAGGCATTTGG + Intronic
1011407312 6:87029639-87029661 CAAAATAAATAGTATGATTTCGG - Intergenic
1013846110 6:114453572-114453594 CATAATCATAAAGAGGAGTTAGG + Intergenic
1015304316 6:131689843-131689865 TATCATCATTAATAGGAGTTTGG + Intronic
1015930848 6:138358028-138358050 CATAATAATGAATATGAATTTGG - Intergenic
1017539751 6:155388455-155388477 TATAATAATTTGAAGGTGTTTGG + Intergenic
1018308130 6:162479770-162479792 AAAAATAATTAGTAGGAGCCAGG + Intronic
1018449180 6:163890780-163890802 TAATATAATTAGTAAGAGTTGGG + Intergenic
1018968392 6:168507248-168507270 CATAAAAATTAACAGGATTTAGG + Intronic
1020372655 7:7451019-7451041 CATAATCATTATTATGAATTTGG - Intronic
1020721263 7:11748357-11748379 GAAAATAATTAGTAGGCGATTGG + Intronic
1021539280 7:21738895-21738917 CATAATAATTATTAGATTTTGGG - Intronic
1022021126 7:26399836-26399858 GAAAATAATTAGGAGGTGTTTGG + Intergenic
1022513758 7:30962322-30962344 CAAAATAAAAACTAGGAGTTAGG - Intronic
1023339052 7:39199832-39199854 CAAAATACTGATTAGGAGTTTGG - Intronic
1026424001 7:70271314-70271336 AATAATAATTGGTAAGACTTTGG - Intronic
1027460720 7:78449752-78449774 TATAACAATTGGTAAGAGTTTGG + Intronic
1028688698 7:93623876-93623898 AATTATTATTAGTAGAAGTTGGG + Intronic
1030940647 7:115644146-115644168 ATTAATAATTTGTGGGAGTTAGG + Intergenic
1034246985 7:149652654-149652676 CATAAAAATTAGTTGGGCTTTGG + Intergenic
1034982318 7:155487092-155487114 CAGAATAAATAGCAGGCGTTGGG - Intronic
1036121612 8:6023820-6023842 CAAAAAAATTGGTAAGAGTTTGG - Intergenic
1037263522 8:17034586-17034608 TATCAACATTAGTAGGAGTTTGG + Intronic
1037350451 8:17948768-17948790 CATAATGACTAGTACTAGTTTGG + Intronic
1037521386 8:19683427-19683449 CATTAGAATTACTAAGAGTTTGG + Intronic
1041795753 8:61746106-61746128 CCTAATAAAAAGTATGAGTTCGG - Intergenic
1042124671 8:65526165-65526187 AATAATAATTGGCAGGGGTTGGG - Intergenic
1044020355 8:87098593-87098615 CAGAATACATATTAGGAGTTTGG + Intronic
1044616059 8:94142955-94142977 TATACACATTAGTAGGAGTTTGG - Intronic
1045597985 8:103678536-103678558 CATGAGAATAAGTAGGAGTATGG + Intronic
1046481512 8:114825111-114825133 CATAACAAATAGTAGGAAATGGG + Intergenic
1048612925 8:136043218-136043240 CATAATGAGTAGTAAGAGATTGG - Intergenic
1050286851 9:4112170-4112192 CACAATTATTAGTCGAAGTTTGG - Intronic
1050902142 9:10962463-10962485 TATTAACATTAGTAGGAGTTTGG + Intergenic
1050931395 9:11331273-11331295 AATAATAATCAGAAGCAGTTTGG - Intergenic
1052372178 9:27677479-27677501 AAAAATAATGAGTAGGAGATTGG - Intergenic
1053387101 9:37701414-37701436 CAGAAGACTGAGTAGGAGTTGGG + Intronic
1061665434 9:132158256-132158278 CATAATAATTAATGGGAGTATGG + Intergenic
1062143607 9:134975561-134975583 TATAATGCTGAGTAGGAGTTGGG - Intergenic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1187807891 X:23141108-23141130 CAGAATAATGGGTAGGATTTAGG - Intergenic
1188333562 X:28899935-28899957 CATGGTAATTAGCAGGAGTCAGG + Intronic
1188679540 X:32984727-32984749 CATTAGAATTTGTAGGAGTAAGG + Intronic
1193481039 X:82029561-82029583 TAGACTAATTCGTAGGAGTTTGG + Intergenic
1194777532 X:97983158-97983180 AATAATTATTAATAGGAGTTAGG - Intergenic
1196581340 X:117382693-117382715 CATAGTAATTTTTAGGAATTGGG + Intergenic
1196664621 X:118303536-118303558 CCTAATAATTAGTGGAAGTCAGG + Intergenic
1197887085 X:131229939-131229961 CATAAGAATTTGTAGTAGATAGG + Intergenic
1198883302 X:141305622-141305644 CATAATGATTATTATGAATTTGG - Intergenic
1199512672 X:148639790-148639812 CATATTAATTGGTAGGATGTGGG + Intronic
1200699059 Y:6386665-6386687 CCCAACAATTTGTAGGAGTTAGG - Intergenic
1200754140 Y:6973944-6973966 CCTAATAATTAATAGGAGTTTGG - Intronic
1200821436 Y:7587675-7587697 CATAAGAATTAGCTGGGGTTGGG - Intergenic
1201035053 Y:9778034-9778056 CCCAACAATTTGTAGGAGTTAGG + Intergenic
1202238868 Y:22745077-22745099 CATAAGAATTAGCTGGGGTTGGG + Intergenic