ID: 1186437059

View in Genome Browser
Species Human (GRCh38)
Location X:9551897-9551919
Sequence TCTGGTGACCCCCACTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186437047_1186437059 19 Left 1186437047 X:9551855-9551877 CCCCGGAGACCCTCCAATCTGAT 0: 1
1: 0
2: 1
3: 10
4: 75
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437048_1186437059 18 Left 1186437048 X:9551856-9551878 CCCGGAGACCCTCCAATCTGATC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437053_1186437059 9 Left 1186437053 X:9551865-9551887 CCTCCAATCTGATCAGATAGGGA 0: 1
1: 0
2: 0
3: 3
4: 134
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437046_1186437059 20 Left 1186437046 X:9551854-9551876 CCCCCGGAGACCCTCCAATCTGA 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437051_1186437059 10 Left 1186437051 X:9551864-9551886 CCCTCCAATCTGATCAGATAGGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437049_1186437059 17 Left 1186437049 X:9551857-9551879 CCGGAGACCCTCCAATCTGATCA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220
1186437055_1186437059 6 Left 1186437055 X:9551868-9551890 CCAATCTGATCAGATAGGGAGGC 0: 1
1: 0
2: 1
3: 9
4: 73
Right 1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186437059 Original CRISPR TCTGGTGACCCCCACTGCAG GGG Intronic
900377530 1:2363035-2363057 TCTGTTGACCCACATTGCTGTGG - Intronic
902549093 1:17208625-17208647 CCTGATGACCCACACTCCAGTGG + Intronic
903957565 1:27035774-27035796 TCTGCTGCCCCCCACCACAGGGG - Intergenic
904310309 1:29625052-29625074 GCTGGTAGCCCCCACTCCAGTGG - Intergenic
905441122 1:37997134-37997156 TCTGGGAACCCAGACTGCAGGGG + Exonic
906369281 1:45238619-45238641 TCAGGTGATCCCCCCTGCATTGG - Intronic
906825593 1:48976184-48976206 TTTGGGAACCCCCTCTGCAGTGG - Intronic
907297463 1:53464540-53464562 TCAGGAGCCCCCCACTTCAGGGG + Intronic
908239694 1:62178457-62178479 TCTGATCACCCCAACAGCAGTGG - Intergenic
912389271 1:109290736-109290758 TCTGGTGATCCCCACTGTAGAGG - Intergenic
912406818 1:109445923-109445945 TCTGGTCACCCAGACTGGAGTGG - Intergenic
914435979 1:147659605-147659627 TCTGGGGAGCCCCACTGCAAAGG - Intronic
916744261 1:167672108-167672130 TCTTGTGACCTCCCTTGCAGAGG + Intronic
917666022 1:177226652-177226674 TCTGGTGACACCCTGAGCAGAGG - Intronic
919418390 1:197340335-197340357 ACTGGTGCCACCCACAGCAGTGG - Intronic
1064695333 10:17959347-17959369 TCTCCTGAACCCAACTGCAGGGG - Intronic
1065141582 10:22723557-22723579 TCAGGAGGCCCCCACTGCAAAGG + Intergenic
1065174772 10:23065557-23065579 TCTGGTGACCCCCTCTCTAGGGG + Intergenic
1066214944 10:33277267-33277289 TCTGGTGAGTCCCACTGAATGGG + Intronic
1066434613 10:35385722-35385744 TCTGATGACGCACACTGCAAAGG - Intronic
1067265172 10:44735537-44735559 GCTGGGGACCCCAACTGTAGTGG + Intergenic
1070508768 10:77140632-77140654 GCTGGTGACCCACACTGCGCTGG - Intronic
1070983176 10:80666471-80666493 CCTGGTGGGCTCCACTGCAGTGG + Intergenic
1072411265 10:95204069-95204091 TCTGGTGACCCAGACTGAAGTGG - Intronic
1072984799 10:100130254-100130276 TCTGCTGCCCCCTGCTGCAGTGG - Intergenic
1073753735 10:106558910-106558932 TCTGGTGCCTCCCATTCCAGAGG - Intergenic
1074559219 10:114520076-114520098 CCTGAAGACTCCCACTGCAGAGG + Intronic
1076112371 10:127871117-127871139 TCCCTTGACCACCACTGCAGAGG - Intergenic
1076621559 10:131792388-131792410 TGTGGTGAGCCCCAGAGCAGAGG + Intergenic
1077104983 11:838300-838322 TCTGGGGACCCCAACCTCAGAGG + Exonic
1077469534 11:2750521-2750543 CCTGGTAACCCTCTCTGCAGAGG + Intronic
1080005148 11:27398762-27398784 TCTGGTAACCACCTCTGCAAAGG - Intronic
1081280236 11:41200896-41200918 TCTATTCACCCCCACTTCAGTGG - Intronic
1084843959 11:71884920-71884942 TCTTAGGACCCCCATTGCAGGGG + Intronic
1085316081 11:75545678-75545700 TCTGGTCTCCCTCAGTGCAGTGG - Intergenic
1085889622 11:80562657-80562679 TCTTGTGAGCACCACTGCAAAGG - Intergenic
1088340603 11:108761736-108761758 TCTGGTGACCCAAATGGCAGAGG - Intronic
1089163579 11:116458040-116458062 TCAGGTGTCCCCCACTTCAGGGG - Intergenic
1089338062 11:117739218-117739240 TCTCCTGACTCCCACTGCACAGG + Intronic
1090357154 11:126147626-126147648 TCTGGGGAGCCCCTCTGCAGGGG - Intergenic
1092537544 12:9403407-9403429 TCTTAAGACCCCCATTGCAGGGG + Intergenic
1092537574 12:9403486-9403508 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1092538007 12:9404756-9404778 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1092538429 12:9405869-9405891 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1094514190 12:31118220-31118242 TCTTAGGACCCCCATTGCAGGGG + Intergenic
1094514219 12:31118300-31118322 TCTTGAGACCCCCATCGCAGGGG + Intergenic
1094514488 12:31119221-31119243 TCTAGGGACCCCCATCGCAGGGG + Intergenic
1094514819 12:31120251-31120273 TCTAGGGACCCCCATCGCAGGGG + Intergenic
1094515021 12:31120939-31120961 TCTTAGGACCCCCATTGCAGGGG + Intergenic
1094515437 12:31122749-31122771 TCTTGGGATCCCCACCGCAGGGG + Intergenic
1095922334 12:47543776-47543798 TATGCGGGCCCCCACTGCAGTGG + Intergenic
1102903526 12:116657438-116657460 ACTGCTCACCCCAACTGCAGAGG + Intergenic
1104804466 12:131576252-131576274 TCGGGTCACACTCACTGCAGCGG - Intergenic
1106392908 13:29353207-29353229 TCTGTTGACCATCACTTCAGTGG + Intronic
1107940643 13:45378026-45378048 TCTCGGGACCCCCATCGCAGGGG - Intergenic
1107941232 13:45380569-45380591 TCTCGGGACCCCCATCGCAGGGG - Intergenic
1107941831 13:45382586-45382608 TCTTGGGACCCCCATCGCAGGGG - Intergenic
1108053358 13:46465399-46465421 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1108053792 13:46467235-46467257 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1108054060 13:46468297-46468319 TCTTGGGACCCCCATTGCCGGGG + Intergenic
1109537626 13:63739514-63739536 TCTTGGGACCCCCATCGCAGGGG - Intergenic
1109537658 13:63739596-63739618 TCTTGGGACCCCCATCGCAGTGG - Intergenic
1109545885 13:63838960-63838982 TCTTAGGACCCCCATTGCAGGGG + Intergenic
1109546408 13:63841085-63841107 TCTTGGGACCCCCATCGCAGTGG + Intergenic
1110891963 13:80705967-80705989 TCTTGGGACCCCCATCGCAGTGG + Intergenic
1110892090 13:80706323-80706345 TCTTGGGACCCCCATCGCAGTGG + Intergenic
1110892374 13:80707468-80707490 TCTTGGGACCCCCATAGCAGAGG + Intergenic
1114066248 14:19061957-19061979 TCTCTGGACCCCCTCTGCAGAGG + Intergenic
1114096020 14:19338067-19338089 TCTCTGGACCCCCTCTGCAGAGG - Intergenic
1115106403 14:29766872-29766894 TCTGGTGTCACTCACTGCATTGG + Intronic
1117787605 14:59303361-59303383 TCTGGTTACCACCACCCCAGTGG + Intronic
1118505049 14:66402163-66402185 CCTGGTGTGCCACACTGCAGAGG - Intergenic
1120195403 14:81476991-81477013 TCTGGTGGCCCCTCCTGCTGGGG + Exonic
1122796795 14:104210126-104210148 CCTGGTGGCCCCCTCTGCAGTGG + Intergenic
1123194829 14:106606317-106606339 TCTGGTGACTCCATCAGCAGTGG - Intergenic
1123222879 14:106872952-106872974 TCTGGTGACTCCATCAGCAGTGG - Intergenic
1123447157 15:20339602-20339624 TCTGGTGACACCCCAGGCAGTGG - Intergenic
1124639007 15:31383439-31383461 CCCTGTGACCCTCACTGCAGAGG - Intronic
1125756032 15:42065602-42065624 TTTGGTGACCTCTGCTGCAGAGG - Intergenic
1127124985 15:55803062-55803084 TCTAGTGGCCACCACTGCATGGG + Intergenic
1128517087 15:68349083-68349105 TGTGGTGCCCCCCACTGCACAGG - Intronic
1129038071 15:72662985-72663007 TCTGGTGTCTCCAGCTGCAGTGG + Intronic
1129211819 15:74074246-74074268 TCTGGTGTCTCCAGCTGCAGTGG - Intronic
1129398584 15:75266838-75266860 TCTGGTGTCTCCAGCTGCAGTGG + Intronic
1129402192 15:75291114-75291136 TCTGGTGTCTCCAGCTGCAGTGG + Intronic
1129475736 15:75783574-75783596 TCTGGTGTCTCCAGCTGCAGTGG + Intergenic
1129728942 15:77918518-77918540 TCTGGTGTCTCCAGCTGCAGTGG - Intergenic
1130569112 15:85024629-85024651 TCTTTTGACCCCCTCTGCTGAGG - Intronic
1131226310 15:90627127-90627149 CCAGGTGACCCCCCCTGAAGGGG - Intronic
1131408425 15:92185610-92185632 TCTGGAGACCCCCAGTGATGGGG - Intergenic
1131508625 15:93036664-93036686 GCTCGTGAGCCCCACAGCAGGGG - Intronic
1132608882 16:805319-805341 TCCTGGGACCCCCAGTGCAGGGG + Intergenic
1132670446 16:1100312-1100334 CCTGCTGACACCCCCTGCAGAGG - Intergenic
1132981882 16:2742493-2742515 TCTCCTGGCCCCCACTCCAGTGG - Intergenic
1134235107 16:12459233-12459255 GCTGGTGAGCCCCACAGGAGAGG - Intronic
1136348992 16:29695006-29695028 CCTGGCGGCCTCCACTGCAGCGG - Exonic
1138652112 16:58466516-58466538 TCTGGTGACCCCATCTGGTGGGG - Intronic
1140918025 16:79511020-79511042 TATAGTCAACCCCACTGCAGCGG + Intergenic
1142312254 16:89320878-89320900 TCTTTTGAGCCCCATTGCAGGGG - Intronic
1143189822 17:5033272-5033294 CCTGGTGGGCACCACTGCAGGGG - Exonic
1143583572 17:7839962-7839984 TCTGTTGTACCCCACTGCTGGGG + Exonic
1143640466 17:8193604-8193626 TTTGCTGAACCCCACTGTAGTGG - Intergenic
1144305178 17:13963357-13963379 TCTGGTGACACCAAGTGCAAAGG - Intergenic
1145003206 17:19320058-19320080 TCTGGTGAGGGCCTCTGCAGGGG + Intronic
1146052719 17:29566465-29566487 TCTGGTGATCCCCAATGCGTGGG - Exonic
1151439817 17:74120886-74120908 TCTGGGGCCTCCCAATGCAGGGG + Intergenic
1151816567 17:76474180-76474202 CCAGGTCACCCCCACTGGAGTGG + Intronic
1152464060 17:80456037-80456059 TCCCGGGACCCCCTCTGCAGGGG - Intergenic
1153839173 18:8990694-8990716 ACTGGTGACCCTCCCTGCCGGGG + Intergenic
1156450958 18:37266324-37266346 TCTGCCCAACCCCACTGCAGGGG + Intronic
1157412164 18:47472117-47472139 CCTGGAGACCCCCACTGCAGGGG - Intergenic
1160804921 19:988410-988432 TCTGGTGACCACCACTGCCCAGG - Intronic
1161224195 19:3135454-3135476 TCAGGTGATCCACCCTGCAGAGG - Intergenic
1161578222 19:5066515-5066537 TCTTGTGTCCCCAACTCCAGAGG + Intronic
1163504918 19:17699960-17699982 TCTGATGCCCCCAACTGCACTGG + Intergenic
1164484534 19:28643472-28643494 TCTGGTGAGCCAGCCTGCAGAGG - Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167520212 19:49950227-49950249 GCTGGTGACCCTGAATGCAGGGG + Exonic
927914722 2:26928059-26928081 TCAGGAGAGCCCCACTGCATGGG + Intronic
931207993 2:60166231-60166253 AGTGCTGACCCACACTGCAGGGG + Intergenic
932352116 2:71041323-71041345 TCTTAGGACCCCCATTGCAGGGG + Intergenic
934674636 2:96241000-96241022 TCTGGTCACCCCCACTGTCAAGG - Intergenic
934921409 2:98347525-98347547 ACCGGAGACCCCCGCTGCAGAGG - Intronic
936596686 2:113854843-113854865 GCTGGTGAGACCCACAGCAGAGG + Intergenic
937707934 2:124942826-124942848 CCTGGGGACCCCCATAGCAGAGG + Intergenic
938384344 2:130853699-130853721 TGTGCTGACTCCCACTGGAGAGG - Intronic
940017102 2:149118231-149118253 TCTGGGGACCACCACTACCGAGG + Intronic
944218318 2:197277484-197277506 TCTGGAGACCGTGACTGCAGAGG + Intronic
946168494 2:217879669-217879691 TCTGGTGACCCCAAGGTCAGAGG + Intronic
946831360 2:223731384-223731406 ACTTGTGACTCCCAGTGCAGAGG - Intergenic
948068367 2:235099629-235099651 TCTGGTGACCCCCTGGACAGAGG + Intergenic
948084597 2:235236828-235236850 TGTGGTGAGCCACACTGCACGGG + Intergenic
948326074 2:237122385-237122407 TCTGCTGACCCCCAGTGGACAGG - Intergenic
948890533 2:240905068-240905090 TCTGTTCACCCCCACTCCTGAGG - Intergenic
1169218782 20:3808581-3808603 CCGGGTTACCCCCACTCCAGAGG + Intergenic
1169254648 20:4087532-4087554 GCTGGAGACCCCTGCTGCAGAGG + Intergenic
1169314178 20:4574448-4574470 TCTTGTATCTCCCACTGCAGTGG - Intergenic
1170893930 20:20397648-20397670 TCTGCTGACCCCCTCTGCCAAGG + Intronic
1172490132 20:35329731-35329753 TCTGGTGGTACCCAATGCAGGGG + Intronic
1173140946 20:40482311-40482333 TCTGGCCATTCCCACTGCAGTGG + Intergenic
1173582436 20:44157121-44157143 TCTGGTGTCCGACACTGTAGTGG + Intronic
1175775242 20:61648961-61648983 TCTGGTCAGCCCTGCTGCAGGGG + Intronic
1178240868 21:30899074-30899096 TCTGGTGATCCACTCTGCTGAGG + Intergenic
1179289147 21:40003634-40003656 CCTTGTGAGCCCCCCTGCAGAGG - Intergenic
1179437365 21:41371145-41371167 TCTTGTGACTCCCACCACAGTGG - Intronic
1179504827 21:41833405-41833427 GCTGGGGACCCCCACTGCTTGGG + Intronic
1179505046 21:41834615-41834637 GCTGGGGACCCCCACTGCTTGGG + Intronic
1180120693 21:45745635-45745657 CCAGGTGACCCTCTCTGCAGAGG + Intronic
1180179337 21:46111089-46111111 TCTGGCGCCCCCCACTGCCTGGG - Intronic
1180484726 22:15784548-15784570 TCTCTGGACCCCCTCTGCAGAGG + Intergenic
1183116320 22:35695244-35695266 TCTTAGGACCCCCATTGCAGGGG - Intergenic
1184482318 22:44755036-44755058 TTTGGTGACCACCATCGCAGTGG - Intronic
1184725641 22:46343775-46343797 TATGGTGACCCCAATGGCAGGGG - Intronic
949883693 3:8679189-8679211 TCTTGGGACCCCCATCGCAGGGG + Intronic
949903503 3:8839079-8839101 CCTGTTGACCCCCACTTCATGGG - Intronic
950030074 3:9846404-9846426 TCTGCTGACCCCCACTCCCCTGG - Intronic
954139065 3:48595663-48595685 TCTGGGCACCCCCACTGGATTGG - Intergenic
955977166 3:64490161-64490183 ACTGGTGGGCCACACTGCAGGGG - Intergenic
957320076 3:78619293-78619315 TCTGGTGACCTCCACAGCTTGGG + Intronic
959138304 3:102453032-102453054 CATGGGGACTCCCACTGCAGAGG + Exonic
961443932 3:126969396-126969418 CCTGGTGAGCCCCTCAGCAGAGG - Intergenic
969022624 4:4148042-4148064 TCTTAGGACCCCCATTGCAGGGG - Intergenic
969518839 4:7664081-7664103 TGTGCTGACCCCTCCTGCAGGGG + Intronic
969522746 4:7688245-7688267 CCTGCTGACCCGCTCTGCAGGGG - Intronic
969787829 4:9473421-9473443 TCTTGGGACCCCCATGGCAGAGG + Intergenic
969787858 4:9473506-9473528 TCTTGGGACCCCCATGGCAGAGG + Intergenic
969787889 4:9473591-9473613 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969787947 4:9473760-9473782 TCTTGAGACCCCCATGGCAGGGG + Intergenic
969788007 4:9473929-9473951 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969788062 4:9474099-9474121 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969788096 4:9474184-9474206 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969788176 4:9474437-9474459 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969788262 4:9474691-9474713 TCTTGGGACCCCCATGGCAGGGG + Intergenic
969788286 4:9474776-9474798 TCTTGGGACCCCCATGGCAGTGG + Intergenic
969788406 4:9475115-9475137 TCTGTGGACCCCCATGGCAGGGG + Intergenic
971520674 4:27546679-27546701 TTTGGTGACCCCCACCACTGTGG + Intergenic
972568989 4:40294026-40294048 TCTGGTGAGCTCTAATGCAGTGG - Intergenic
974962845 4:68725057-68725079 TCTGGGCAGCCCGACTGCAGGGG - Intergenic
977707310 4:100086355-100086377 TCTGGGAAGCCCCACTGCTGTGG + Intergenic
978785158 4:112601017-112601039 TCTGATCACCCCAACAGCAGAGG + Intronic
983702467 4:170614827-170614849 TCTTGTGACCTCTAGTGCAGTGG + Intergenic
985066460 4:186126854-186126876 TCTGGAGAACCCCAATACAGGGG + Intronic
985511033 5:314043-314065 CCAGGTGGCCCCCACAGCAGAGG + Intronic
986383147 5:7206584-7206606 TCTGGACACCCCCACTACTGTGG + Intergenic
986413998 5:7510361-7510383 TATAGTGACAGCCACTGCAGGGG - Intronic
986664799 5:10091945-10091967 TCTTGGGACTCCTACTGCAGCGG - Intergenic
986796660 5:11219196-11219218 CCAGGTGACCCCCACTGCATGGG - Intronic
997214623 5:132100608-132100630 TCAGGTGTCTCCCACTCCAGAGG + Intergenic
998934872 5:147224381-147224403 TCTGGAGCCCCCCAGTGGAGAGG - Intergenic
999126847 5:149252254-149252276 CCTGGTGATCCCCAGTGTAGCGG - Intronic
1001539910 5:172530565-172530587 TCTGCTGATGCCCACTCCAGAGG + Intergenic
1006102282 6:31693072-31693094 TCTGCTGTCCCCCGGTGCAGGGG + Exonic
1006474067 6:34244063-34244085 TGGGGTGACCCTAACTGCAGTGG - Intronic
1007112374 6:39320328-39320350 TCTGGAGACCCTCACTTCTGGGG + Intronic
1007712949 6:43836265-43836287 CCTGGTGACACCTACTGAAGGGG + Intergenic
1011739788 6:90348265-90348287 TCTGGCCTCCTCCACTGCAGAGG - Intergenic
1014645344 6:123966047-123966069 TTTGGTGACACCCACTGGACAGG + Intronic
1014747410 6:125216016-125216038 TCTGCTGACCCCCACTGCAGGGG + Intronic
1017188750 6:151629310-151629332 TCTGGTTACCCTCAGTGCAGAGG + Intergenic
1019033124 6:169030632-169030654 TCTGGGGTCCCCCACATCAGGGG + Intergenic
1020112403 7:5454972-5454994 TCTGGTTTCCCCAACTGTAGGGG - Intronic
1023867251 7:44244142-44244164 TCTGGTCATCCCCACTACATGGG + Intronic
1023950587 7:44840898-44840920 TCTGGAGTACCTCACTGCAGAGG - Exonic
1024045708 7:45584312-45584334 TCTGGTGGCCCCCACTTCCTGGG + Intronic
1024638803 7:51312752-51312774 TCTCGTGACCTCCAGTGCACAGG - Intronic
1026415808 7:70179330-70179352 TTTGGTCACCCCTACAGCAGGGG + Intronic
1028447491 7:90941901-90941923 CCTGGTGTCTTCCACTGCAGTGG + Intronic
1029126346 7:98297420-98297442 GCTGGTGGCCCTCACTGCAGAGG + Intronic
1029710162 7:102295034-102295056 TCAGGTGGCCCTCACTGGAGTGG - Intronic
1030626344 7:111849732-111849754 TCTGGGGACCCCTGCTCCAGTGG - Intronic
1034303163 7:150033609-150033631 TCTTAGGACCCCCATTGCAGCGG - Intergenic
1036833997 8:12043202-12043224 TCTTAGGACCCCCATTGCAGCGG - Intergenic
1036855843 8:12289767-12289789 TCTTAGGACCCCCATTGCAGCGG - Intergenic
1038659259 8:29482646-29482668 TCTGGTGGCCCCCAGTGTAGAGG + Intergenic
1039270985 8:35880136-35880158 TCTTGTGATGCACACTGCAGGGG + Intergenic
1041773650 8:61499669-61499691 GCTGGTGACAGTCACTGCAGGGG - Exonic
1049359444 8:142205399-142205421 TCTGGTGGCCTCTCCTGCAGGGG + Intergenic
1049649735 8:143760137-143760159 TCTGGAGCACCCCACTGAAGGGG + Intergenic
1049664612 8:143837398-143837420 ACTGCTCACCGCCACTGCAGCGG + Exonic
1053736714 9:41107160-41107182 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1053736745 9:41107238-41107260 TCTTGGGACCCCCATCGCAGGGG + Intergenic
1053737159 9:41108781-41108803 TCTTGGGACCCCCATCGCAGTGG + Intergenic
1053737245 9:41109021-41109043 TCTTGGGACCCCCATAGCAGAGG + Intergenic
1054691105 9:68322298-68322320 TCTTGGGACCCCCATAGCAGAGG - Intergenic
1054691189 9:68322536-68322558 TCTTGGGACCCCCATCGCAGTGG - Intergenic
1054691627 9:68324160-68324182 TCTTGGGACCCCCATCGCAGGGG - Intergenic
1054691657 9:68324240-68324262 TCTTGGGACCCCCATCGCAGGGG - Intergenic
1060070430 9:120542268-120542290 TCAGGTGATCCCCCCTGCATTGG - Intronic
1060214050 9:121727685-121727707 GTTGGGGGCCCCCACTGCAGGGG + Intronic
1061040418 9:128138394-128138416 TCTTGGGACCCCCATCGCAGTGG - Intergenic
1061420539 9:130470981-130471003 CCTGGTGACCCCCACACCAGTGG + Intronic
1061941605 9:133887036-133887058 TCTGGGAACCACCACTGCTGAGG - Intronic
1185668690 X:1788391-1788413 TGTGGTCACTCCCTCTGCAGAGG + Intergenic
1186437059 X:9551897-9551919 TCTGGTGACCCCCACTGCAGGGG + Intronic
1186545443 X:10444378-10444400 TTTGCTGACCCCTACTGTAGTGG - Intergenic
1187506172 X:19880198-19880220 CCTGGTGGCCCACACTGTAGTGG - Intronic
1190411747 X:50143482-50143504 TCTGGTGACCCTCACTGATCTGG + Intergenic