ID: 1186438107

View in Genome Browser
Species Human (GRCh38)
Location X:9560826-9560848
Sequence TGTCATCTGTCGACAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186438107_1186438109 -9 Left 1186438107 X:9560826-9560848 CCTCCTGTTGTCGACAGATGACA 0: 1
1: 1
2: 0
3: 5
4: 57
Right 1186438109 X:9560840-9560862 CAGATGACACCTGCACAATCAGG 0: 2
1: 1
2: 17
3: 770
4: 1815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186438107 Original CRISPR TGTCATCTGTCGACAACAGG AGG (reversed) Intronic
919026536 1:192178552-192178574 TTTCATCTCTCCACAACAGCAGG - Intronic
924572413 1:245249063-245249085 TGGCAGCTGTCTATAACAGGTGG + Intronic
1062996039 10:1868593-1868615 TGTCCACTGTCAACAACAGTGGG - Intergenic
1063613321 10:7581428-7581450 AGGCATCTGTGGACAGCAGGAGG + Intronic
1070412584 10:76156528-76156550 TGTCATCTGTGGCCATCAGAAGG - Intronic
1074917590 10:117972251-117972273 TGTCATTTGTCAAGAACAGGAGG - Intergenic
1075869430 10:125759078-125759100 TGTCATAGGTCTACAGCAGGAGG + Intronic
1090307376 11:125703000-125703022 TGTAAGCTGTTAACAACAGGGGG + Intergenic
1092163145 12:6327281-6327303 TGTCTTCTGTCACCACCAGGTGG - Exonic
1093993597 12:25617401-25617423 TGTCTACTGTAGACAAGAGGGGG + Intronic
1094489440 12:30949788-30949810 TTTCATCTGTGGAGGACAGGTGG - Intronic
1107416813 13:40208742-40208764 TGTCATCTGTTGAGACCTGGTGG - Intergenic
1109599271 13:64601802-64601824 TGTCATCTGTAATAAACAGGTGG + Intergenic
1115306122 14:31935647-31935669 TGTCATCTGCCCCCAGCAGGAGG + Intergenic
1115821827 14:37221279-37221301 TGTCATCTCATGGCAACAGGTGG + Intronic
1119569072 14:75654167-75654189 TGGCATCTGGGGAAAACAGGAGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130284850 15:82546437-82546459 TTTCTTCTGTCGAGATCAGGTGG - Exonic
1131158030 15:90086977-90086999 GGTCCTCTGTGGACAGCAGGGGG - Intronic
1134339972 16:13335852-13335874 TTTCTTCTGTAGACACCAGGGGG - Intergenic
1137978757 16:53052870-53052892 TGTCATCTGTGGACAATACCTGG - Intergenic
1142270695 16:89088013-89088035 TGCCCTGTGTCGGCAACAGGAGG - Intergenic
1144213590 17:13035336-13035358 TTTCATATTTCAACAACAGGAGG - Intergenic
1151773647 17:76182352-76182374 TTTCATCTTTCGTCACCAGGTGG - Intronic
1156232692 18:35169828-35169850 TGTCATCAGCTGAGAACAGGAGG - Intergenic
1160157839 18:76446997-76447019 AGTCAACTGTGGACATCAGGAGG - Intronic
1168416430 19:56172067-56172089 TGTCTTCTGTCGCCAGGAGGGGG - Intergenic
925262340 2:2539707-2539729 TGTCACCTGTTGTCAACTGGTGG - Intergenic
927373325 2:22383132-22383154 TGTCTTCTGTGGACAAAAGGAGG + Intergenic
932835584 2:75032914-75032936 TGTCATCCCACGACAAAAGGTGG - Intergenic
938962900 2:136359048-136359070 TGTCAAGTGTTGACAACAGAAGG + Intergenic
940091630 2:149926113-149926135 TGTCCTCAGTGGAAAACAGGTGG + Intergenic
1169789813 20:9397913-9397935 TGTCATCTGCTGACAAAAGCAGG - Intronic
950233385 3:11296234-11296256 TTTCAGCTGTGGACAACAGCAGG - Intronic
953619746 3:44522883-44522905 GGTCATCTGTTGTCAGCAGGGGG - Intergenic
960555514 3:119025053-119025075 TGTAATCTTTCTACAACAGATGG + Intronic
971080998 4:23211009-23211031 TGTGATCTGTGGACAGCAGTTGG + Intergenic
976177132 4:82366045-82366067 TGTCATCTGTAGAAAGCTGGGGG - Intronic
980839829 4:138244897-138244919 TGTGATCTGACAACAACTGGTGG + Intergenic
986916814 5:12629540-12629562 TATCATCTGTCCTCTACAGGTGG + Intergenic
991001783 5:61790323-61790345 TGTCTTCTGTGGACTCCAGGTGG + Intergenic
1004706276 6:18126833-18126855 TGTTAACTTTCGACAACAGGAGG - Intergenic
1007058843 6:38917592-38917614 TGACATCTGTCCAGAACCGGTGG + Intronic
1010371255 6:75110638-75110660 TGTCATCTTTCAACAATAGAAGG + Intronic
1010906028 6:81490189-81490211 GGTCATCTCTCTAAAACAGGAGG + Intergenic
1013603188 6:111724401-111724423 TGTGGTCTGTCTACATCAGGAGG - Intronic
1015578123 6:134694340-134694362 TGTCATTTGCCAACAACATGAGG - Intergenic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1026066212 7:67075528-67075550 TGTCATCTGTCAATAAAAAGAGG + Intronic
1026505083 7:70975701-70975723 TGTCAACTGCTGAGAACAGGAGG + Intergenic
1038797114 8:30719740-30719762 TGTTATCTGGTGATAACAGGTGG + Intronic
1038981052 8:32760256-32760278 TGTCATCCGTAGAAAACAGTAGG + Exonic
1044595917 8:93958211-93958233 AGCCATCTGTTGAGAACAGGTGG - Intergenic
1050574479 9:6979156-6979178 TGTAATCTTTTGACAAAAGGGGG - Intronic
1051467716 9:17399636-17399658 TATCATCTGTTTACAAAAGGTGG - Intronic
1056714807 9:89020395-89020417 TGTGGTCTGTGGACAACAGCAGG + Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1062550327 9:137083094-137083116 TGTCATCTGGGGAGAACAGGAGG + Exonic
1062621596 9:137424778-137424800 TGTAATCTTTAGACACCAGGTGG + Intronic
1186438107 X:9560826-9560848 TGTCATCTGTCGACAACAGGAGG - Intronic
1190708440 X:53049017-53049039 TGTCTTCTGAGGACAAAAGGCGG + Intergenic
1191108329 X:56786184-56786206 TGTCATCAGCCGACTACAAGGGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1200754469 Y:6977300-6977322 TGTCATCTGTCAACAACAGGAGG - Intronic