ID: 1186439269

View in Genome Browser
Species Human (GRCh38)
Location X:9571234-9571256
Sequence CTGTGTATGGGTGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 1, 1: 1, 2: 6, 3: 66, 4: 794}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186439259_1186439269 3 Left 1186439259 X:9571208-9571230 CCTCACACGGCCTTTCCTCGGAG 0: 1
1: 0
2: 20
3: 161
4: 537
Right 1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG 0: 1
1: 1
2: 6
3: 66
4: 794
1186439255_1186439269 20 Left 1186439255 X:9571191-9571213 CCGCCTTCTTGCTGTGTCCTCAC 0: 106
1: 291
2: 643
3: 1070
4: 1751
Right 1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG 0: 1
1: 1
2: 6
3: 66
4: 794
1186439256_1186439269 17 Left 1186439256 X:9571194-9571216 CCTTCTTGCTGTGTCCTCACACG 0: 12
1: 355
2: 1019
3: 2121
4: 3115
Right 1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG 0: 1
1: 1
2: 6
3: 66
4: 794
1186439260_1186439269 -7 Left 1186439260 X:9571218-9571240 CCTTTCCTCGGAGCGTCTGTGTA 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG 0: 1
1: 1
2: 6
3: 66
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186439269 Original CRISPR CTGTGTATGGGTGGGGTGGA GGG Intronic
900291516 1:1925636-1925658 CTGTGTAGAGGAGGGGTAGAGGG + Intronic
900627848 1:3617473-3617495 CTGTGGAGGGGTGGTGGGGAGGG + Intergenic
900650184 1:3726626-3726648 GGGTGGATGGATGGGGTGGATGG + Intronic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
900989052 1:6089599-6089621 CTGGGTTGGGGTGGGGAGGATGG - Intronic
902397952 1:16142724-16142746 GTATGGATGGGTGGGGAGGATGG + Intronic
902977519 1:20099672-20099694 CTGTGTATGTGTGGGTTGACTGG + Intergenic
903269102 1:22176729-22176751 TTGTGTGTGGGTGGGGTGGGGGG + Intergenic
903302204 1:22387094-22387116 CTGGGACTGGGTGGGGTGGAGGG + Intergenic
903673307 1:25049297-25049319 GTGAGTGTGCGTGGGGTGGAGGG - Intergenic
904209482 1:28877234-28877256 ATGTGTATGGGTCAGGTGTATGG - Intergenic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
904345163 1:29863108-29863130 CTGAGTAGGGGTGGGGAGGGAGG + Intergenic
904618509 1:31762599-31762621 ATGGGTTGGGGTGGGGTGGAGGG - Intronic
904887029 1:33746646-33746668 CTGTGTATGTGTTGGGGAGAGGG - Intronic
905393252 1:37651389-37651411 CTGGGGATTGGAGGGGTGGAGGG - Intergenic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906243699 1:44258357-44258379 CTTTGTATGTGAGGGGTGGCTGG - Intronic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907998334 1:59655424-59655446 CTGTGGTGGGGTGGGGTGGAGGG - Intronic
908285027 1:62587803-62587825 CTGTGTGGGGGTGTGGGGGAAGG + Intronic
908492366 1:64658940-64658962 TTTTGGAGGGGTGGGGTGGATGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909438310 1:75669675-75669697 GTGTGTATGTGTGGTGGGGATGG - Intergenic
910818729 1:91321652-91321674 GTGTGTACGTGTGGGATGGAGGG - Intronic
911745619 1:101438888-101438910 GTGTGTATGGGTGGGGGTGAGGG + Intergenic
912411523 1:109483781-109483803 CTGTGAGTGGGTGGGGGGGGGGG + Intronic
912452877 1:109778107-109778129 GTGTGCATGGCAGGGGTGGATGG + Intergenic
912602289 1:110949087-110949109 GTGTGTGTGTGTGGGGTGGGCGG + Intronic
912669415 1:111610523-111610545 GTGTGTGTGTGTTGGGTGGAGGG - Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913170452 1:116227432-116227454 GTGGGTAGGGGTGGGGTGGCAGG - Intergenic
913984097 1:143549628-143549650 TTGTGTTTGGATGGGGTTGAAGG + Intergenic
914770096 1:150676367-150676389 CTGGGTTTGGGTGGGGTGGGTGG - Intronic
914925095 1:151878283-151878305 CTATGTGTGTGTGGAGTGGAGGG - Intronic
915034827 1:152912840-152912862 CTGGGGTTGGGTGGGGAGGAAGG - Intergenic
915093526 1:153443438-153443460 CTGTGTCCTGATGGGGTGGAGGG - Intergenic
915443696 1:155962462-155962484 CTGTGTATGGATGGTCTGCACGG + Intronic
915476602 1:156156242-156156264 TTGTGTTGGGGTGGGGTGAAGGG + Intronic
915589631 1:156863063-156863085 ATGTGTATTGTTGGGGTGGGGGG + Intronic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916990576 1:170239640-170239662 CTGTGTATGGGTGGGGAGGGAGG + Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917209758 1:172619865-172619887 CTGTGTCTTGGTGGGGTTGTGGG - Intergenic
917463665 1:175255155-175255177 ATGTGTGTGTGTGGGGTGGGTGG + Intergenic
918329029 1:183438503-183438525 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
918539354 1:185612106-185612128 GTGTGTAGGGGTGGTGGGGAGGG - Intergenic
919616060 1:199810633-199810655 TTCTGTATGGATGGGGTGCAGGG + Intergenic
919723653 1:200867000-200867022 GTGTGTGTGAGTGGGGTGGGGGG - Intergenic
919790115 1:201285213-201285235 GTGTGTGTGTGTGTGGTGGAAGG - Intronic
920693774 1:208166069-208166091 CTTTGTAAAGGTGGGGTGGTGGG - Intronic
921249196 1:213280671-213280693 GTGTGTATGTGTGGGGTGAGGGG + Intergenic
922205106 1:223439318-223439340 ATGTGTTTGGGTGGGGTGGGAGG + Intergenic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922746417 1:228046923-228046945 CTGTGCATGCATGTGGTGGAAGG + Intronic
922879414 1:228969428-228969450 TGGTGTATGGTTGGGGAGGATGG - Intergenic
923030519 1:230245900-230245922 CTGGGTCTGGGTGGGGAGGCTGG + Intronic
923145825 1:231196954-231196976 CTGTGTAGGGATGGGGTGGACGG + Intronic
923420913 1:233813947-233813969 GTGTGTCTGGGCGGGGTGGGAGG + Intergenic
923743546 1:236678765-236678787 CTGGGTGTGGGTGGGAAGGAAGG - Intergenic
924318212 1:242820535-242820557 CTGTGTATGTGTGGGGACAAGGG + Intergenic
924382942 1:243480589-243480611 GGGTGGATGGGTGGGATGGATGG + Intronic
924383022 1:243480833-243480855 GGATGGATGGGTGGGGTGGATGG + Intronic
924414878 1:243849543-243849565 GTGTGTTTGGGTTGGGGGGAGGG - Intronic
924487434 1:244499490-244499512 CTGTCGAGGGGTGGGGGGGAAGG - Intronic
924610213 1:245567455-245567477 CTGGGGATGGGAGGGGTGAAGGG - Intronic
924641567 1:245838192-245838214 AGGTGTGTGGGTGGGGTGCATGG + Intronic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062827354 10:582315-582337 CTGTATTTGGGTTGGGTGCATGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062861648 10:815135-815157 CTGTTCACGGGTGGGGTGAACGG - Intronic
1062866528 10:860116-860138 ATGTGTGGGGGTGGGGGGGAGGG + Intronic
1063122983 10:3117662-3117684 CTGTGTGTGGGTGCCCTGGACGG + Intronic
1063348912 10:5336652-5336674 GTGTGTATGTGTGTTGTGGAGGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063578571 10:7284277-7284299 CTGGGCAAGGATGGGGTGGAGGG - Intronic
1064323554 10:14328358-14328380 GTGTGTGTGGGTGGGGGGGGGGG + Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1066271586 10:33829369-33829391 CTGTGTATGTATGGGCTGGCAGG + Intergenic
1066360726 10:34727807-34727829 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1069465910 10:68638797-68638819 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1070534124 10:77362356-77362378 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1072107627 10:92289912-92289934 GTGTGTATGTGTGTGGTGGGGGG + Intronic
1072752194 10:97989271-97989293 CTGTGTGTGCGTTGGGTGGGGGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073183528 10:101601366-101601388 TTGTGTATGAGCGGGGTGTAGGG + Intronic
1074424382 10:113338228-113338250 CTGGGTAGGGGTGGGGAGGAGGG + Intergenic
1074723262 10:116282185-116282207 GTGTGTATGGGTGGGTGGGTGGG - Intergenic
1074828795 10:117233538-117233560 CTGTCTCTGGCTGGGGAGGAAGG + Intergenic
1074859958 10:117502604-117502626 GTTAGAATGGGTGGGGTGGATGG + Intergenic
1074899937 10:117807331-117807353 CTGTGGAGGGGTGGGTTGAATGG - Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075923934 10:126235608-126235630 CTGAGTGTGGCTGGGCTGGACGG - Intronic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076132042 10:128019862-128019884 GTGAGGATGGTTGGGGTGGACGG + Intronic
1076189312 10:128471431-128471453 GTGTGTGTGTGTGGGGGGGATGG - Intergenic
1076234057 10:128850128-128850150 CTGTAAATGGGTGGGGTGCTTGG + Intergenic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076896920 10:133317564-133317586 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076896975 10:133317738-133317760 CTGTGTCTGGGCGGGGTGTGTGG - Intronic
1076897082 10:133318110-133318132 CTGTGTCTGGGCGGGGTGTGTGG - Intronic
1076897104 10:133318207-133318229 CTGTGTCTGGGGGGGGTGTGTGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077305576 11:1867338-1867360 GTGTGTGTGGGTGTGGTGGGTGG - Intronic
1077349342 11:2085126-2085148 GTGTGCATGGGTGTGTTGGATGG - Intergenic
1077544507 11:3163513-3163535 CTGGGTAGGGGTTGGGTGGGGGG + Intronic
1078088921 11:8251726-8251748 GTGTGTATGGGGGGGGTATAGGG + Intronic
1078250424 11:9612552-9612574 CTTTTTTTGGGTGGGGGGGATGG + Intergenic
1078429742 11:11279999-11280021 CTGTGTATGTGTGTGTTGGGAGG + Intronic
1078488917 11:11751256-11751278 CTGTATGTGTGTGGGGTGGGTGG - Intergenic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1078946473 11:16073608-16073630 CTGTTTTTTTGTGGGGTGGAGGG - Intronic
1079084056 11:17432763-17432785 CTGTGTGCGGGTGGGGTAGCTGG + Intronic
1079224875 11:18596359-18596381 CTGGGCATGGGTGTGATGGATGG - Intergenic
1079327081 11:19503208-19503230 CTGTGTATGTGTGGGGGGCAAGG - Intronic
1081051080 11:38342468-38342490 TTGTGTATTTGTGTGGTGGATGG + Intergenic
1082068921 11:47922914-47922936 CTGTGGATGTGTGGGAGGGAAGG - Intergenic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1083188778 11:61034799-61034821 CTGGGTGGGGGTGGGGTAGAGGG - Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083744702 11:64728928-64728950 CTGTGCATGGGTGAGGGTGAGGG + Exonic
1083773227 11:64879647-64879669 CTGTGTGTGGCCGGGGAGGATGG - Intronic
1083990524 11:66243452-66243474 CTGTGCAGGGGTGGGCTGGAGGG - Exonic
1084402967 11:68955894-68955916 CTGTGTGTGGCTGGGAAGGAGGG - Intergenic
1084609768 11:70194663-70194685 GTGTGGATGGATTGGGTGGATGG + Intergenic
1084693672 11:70741375-70741397 GAATGTATGGGTGGGATGGATGG - Intronic
1084725349 11:70938229-70938251 GTATGTGTGGGTGTGGTGGAGGG + Intronic
1084870376 11:72094820-72094842 CTGTGGAGGGTTGGAGTGGAGGG + Intronic
1084888666 11:72225642-72225664 CCGTGTATGGGTGGTGGGGGCGG + Intronic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1085043808 11:73342203-73342225 CAGTCTAGGGGTGGGGCGGATGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085198096 11:74684174-74684196 CTGTGTAAAGGAGGGGTTGAAGG + Intergenic
1085341233 11:75732890-75732912 CTGTTTGTGGGTAGGCTGGAGGG - Intronic
1085393509 11:76194540-76194562 CTGGGGGTGGGTGGGGTGGGTGG + Intronic
1085448646 11:76617494-76617516 CTGGGTCTGAGAGGGGTGGAGGG + Intergenic
1085756067 11:79202248-79202270 CAGAGCATGGGTAGGGTGGAAGG - Intronic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1086976939 11:93142939-93142961 CTGTTTGGGGGTGGGGTGGGAGG + Intergenic
1088187373 11:107186611-107186633 CTGAGCCTGGGTGGGGTTGAGGG - Intergenic
1088297430 11:108315866-108315888 GTTTGTATGGCTGTGGTGGAGGG + Exonic
1089673876 11:120075962-120075984 GTGTGTTGGGGTGGGGAGGAGGG + Intergenic
1089736288 11:120552306-120552328 ATGTGTGGGGGTGGGGTGGGGGG - Intronic
1089797330 11:120992096-120992118 GTGTGTATGAGTGTGGTGTAGGG + Intergenic
1090354484 11:126130695-126130717 CTGTTTAGGGGTACGGTGGAAGG - Intergenic
1090479299 11:127054069-127054091 CTTTGGGTGGGTGGGGTGGGAGG - Intergenic
1091012318 11:132014039-132014061 CTGTGAAGGGGTGGAGAGGAAGG - Intronic
1091041635 11:132286514-132286536 GTGTGTTTGGGTGGGGGGGGCGG - Intronic
1091136941 11:133200076-133200098 CTGTGTAGGGGTGGGGGAAATGG - Intronic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091658043 12:2360168-2360190 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1092322804 12:7496321-7496343 CTGTCAATGGGTGGGGGGAAAGG + Intronic
1092361508 12:7840526-7840548 CTGGGTGTGGGTGTGGTGGCGGG - Intronic
1094467789 12:30771959-30771981 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
1095130977 12:38541933-38541955 GTGTGTATGTGTTGGGTGGATGG + Intergenic
1095346539 12:41156707-41156729 CTGTCAGTGGGTGGGGTGAAGGG - Intergenic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096633655 12:52945303-52945325 CTGTGGTGGGGTGGGCTGGAGGG - Intronic
1097174139 12:57133196-57133218 GTGTGTGTGGCTGGGGTGGGGGG + Intronic
1097957910 12:65505632-65505654 CAGTGTAGGGCTGGGGAGGAGGG - Intergenic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1098281901 12:68870502-68870524 GTGAGTATGGGTGTGGTGGATGG + Intronic
1098597801 12:72294356-72294378 CTGTGTGTGTGTGTGGTGGGGGG + Intronic
1099143007 12:79003299-79003321 GTGTGTATGTGTGTGGTGGGGGG - Intronic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100219829 12:92492981-92493003 CTGTGTTGGGGTTGGGAGGAGGG + Intergenic
1100480231 12:94970781-94970803 TTGTGTCTGGGTAGGGTGAAAGG - Intronic
1100524269 12:95405285-95405307 GTGGGTATGGGTGGGGGGGGTGG - Intergenic
1101026523 12:100612750-100612772 ATGTGTGGGGGTGGGGTGGTGGG - Intronic
1101254140 12:102960937-102960959 CTAGGTCTGGGTGGGGAGGATGG + Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102535466 12:113577452-113577474 CAGTGTGTTGGTGGGGGGGAGGG - Intergenic
1102567710 12:113807834-113807856 CTGGCTATGGTTGGGATGGAAGG - Intergenic
1103558484 12:121779812-121779834 CAGTGTGTGGGTGGAATGGAGGG + Exonic
1103797218 12:123512268-123512290 CTGTGTGTGGGTGGTGTGTGAGG + Intronic
1104557885 12:129818417-129818439 GTGTGTATGTGTGTGGTGGGGGG + Intronic
1104979108 12:132565279-132565301 CTGGGAATGGCGGGGGTGGAGGG - Intronic
1105437999 13:20393126-20393148 CTGTGTGTGTGTGGTGTGGCTGG - Intergenic
1105547020 13:21358189-21358211 CTGTGCATGTGTAGGGGGGAAGG + Intergenic
1105604511 13:21915761-21915783 CTGTGTGAGGGCGGAGTGGATGG - Intergenic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106370978 13:29132450-29132472 CTGTGGATGGGTGGTGGTGATGG - Intronic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1107077974 13:36344384-36344406 GTGTGTAGGGGTGGAGTGGGAGG + Intronic
1107484463 13:40813125-40813147 GTGTGTGTGGGTGGGGGGGGGGG - Intergenic
1108423214 13:50271627-50271649 ATGTGTATGTGTAGGGTGGCTGG + Intronic
1108563854 13:51674727-51674749 CTGTATGTGGGTGGGGAGGGTGG + Intronic
1108615931 13:52132065-52132087 CAGCGTATGTGTGAGGTGGAGGG + Intergenic
1108965699 13:56297836-56297858 GTGTGTGTGTGTGTGGTGGAAGG - Intergenic
1109013346 13:56977023-56977045 GTGTGTGTGGGTGTGGTGGTAGG + Intergenic
1109800924 13:67377711-67377733 CTGTGTGTGGGAGTGGGGGAGGG - Intergenic
1109849620 13:68044192-68044214 GTTTGTATGTGTGTGGTGGAGGG - Intergenic
1110408623 13:75179121-75179143 GTGTGTGTGGGTGGGGGGGGCGG + Intergenic
1110416585 13:75260104-75260126 GTGGGGGTGGGTGGGGTGGAGGG - Intergenic
1111649314 13:91069202-91069224 GTGTGTCTGGGTGGGGTGGGGGG + Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112641689 13:101282649-101282671 CTCTGTGTGTGTGGGGTGGGGGG - Intronic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1112704130 13:102047259-102047281 ATGTGTATGTGTGGGATGGTAGG - Intronic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113203474 13:107891706-107891728 CTGTGGTGGGGTGGGGGGGAGGG + Intergenic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113468708 13:110530118-110530140 CTGTGTAGAGGTGGGGTGGTGGG - Intronic
1113468725 13:110530165-110530187 CTGTGTAGAGGTGGGGTGGTGGG - Intronic
1113468830 13:110530453-110530475 CTGTGTAGAGGTGGGGCGGGTGG - Intronic
1113468845 13:110530501-110530523 CTGTGTAGAGGTGGGGCGGGTGG - Intronic
1113468860 13:110530549-110530571 CTGTGTAGAGGTGGGGCGGGTGG - Intronic
1113468890 13:110530643-110530665 CTGTGTAGAGGTGGGGCGGGTGG - Intronic
1113468933 13:110530787-110530809 CTGTGTAGAGGTGGGGTGGGTGG - Intronic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113626007 13:111846987-111847009 CTGGGTTTGGGTTGGGTGAAGGG - Intergenic
1114671169 14:24411843-24411865 CTGTGCATGGCTGATGTGGATGG + Intronic
1115005456 14:28477499-28477521 CTGTCAGTGGGTGGGGTGGGTGG - Intergenic
1115039770 14:28909321-28909343 CTGTAGATGGGTGGGGTGCTAGG + Intergenic
1115278138 14:31631232-31631254 CTGTGTGTGTGTGGGTTGGGGGG + Intronic
1115452709 14:33566451-33566473 ATTTGGAAGGGTGGGGTGGAAGG - Intronic
1115471301 14:33771311-33771333 GTGTGTATGTGTGGGTTTGAGGG - Intronic
1115549189 14:34489774-34489796 CTGTGTTTTGGTTAGGTGGAGGG + Intergenic
1115671534 14:35617621-35617643 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
1117992144 14:61444587-61444609 CAGTGTATGGGTGTGGAGGGGGG - Intronic
1118359617 14:65044885-65044907 ATGTGTAGGGGTGGGTTGTAGGG + Intronic
1118555830 14:67019981-67020003 GTGTGTACAAGTGGGGTGGAGGG + Intronic
1118568694 14:67171649-67171671 CTGTGTTTGTGAGGGGGGGATGG - Intronic
1118807772 14:69252727-69252749 TTGTGTATGGGTGGGTGGGCGGG - Intergenic
1119231479 14:72983345-72983367 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
1119331558 14:73798638-73798660 CTTTATATGGGTGAGTTGGATGG + Intergenic
1119744504 14:77034199-77034221 CTGTGCCTGGTTGGGATGGATGG + Intergenic
1119772056 14:77226235-77226257 TTGGGTAGGGGTGGGGTGGAGGG - Intronic
1119864908 14:77965425-77965447 ATGTGTAGGGGTGGGGTGGGAGG + Intergenic
1121341189 14:93106170-93106192 CTGTGGGGTGGTGGGGTGGATGG - Intronic
1121483141 14:94293478-94293500 CTCTGTCTGGGTGGGGTGTGGGG + Intergenic
1121719932 14:96102097-96102119 GTGTGTATGCGTGGGGTTGGGGG + Intergenic
1122110451 14:99497001-99497023 CTGTGCATGTGTTGGGTGGGGGG - Intronic
1122276463 14:100593235-100593257 CTGTGGGTGGTCGGGGTGGAGGG - Intergenic
1122324350 14:100873715-100873737 ATGTGTGTTGGTGGTGTGGATGG + Intergenic
1122550443 14:102546216-102546238 CTGTGTATGGGTGGAGGAGGCGG + Intergenic
1122879472 14:104683605-104683627 CTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1123057307 14:105577493-105577515 CTGTCTGTGGGTGGGGGGCACGG - Intergenic
1123057852 14:105580346-105580368 CTGTCTGTGGGTGGGGGGCACGG - Intergenic
1123080506 14:105691581-105691603 CTGTCTGTGGGTGGGGGGCACGG + Intergenic
1123082135 14:105700279-105700301 CTGTCTGTGGGTGGGGGGCACGG - Intergenic
1123432116 15:20226790-20226812 CTGGGTGTGTGAGGGGTGGAGGG - Intergenic
1123931073 15:25171902-25171924 CTGTGTTTGGGAGGTGTGTAGGG + Intergenic
1123938934 15:25207412-25207434 CTGTGTTTGGGAGGTGTGCAGGG + Intergenic
1123945987 15:25239140-25239162 CTGTGTGTGGGAGGTGTGCAGGG + Intergenic
1124273470 15:28304862-28304884 CTGTGGTGGGGTGGGGTGGGGGG - Intronic
1124653073 15:31487056-31487078 GTGGGTATGGCTGGGGTGGGCGG + Intronic
1124699408 15:31899390-31899412 CTGTTGATGGGTGGGGAGCAAGG + Intergenic
1125025332 15:35023947-35023969 CAATGCATGGGCGGGGTGGAGGG - Intergenic
1125252212 15:37717958-37717980 CTGTTAGGGGGTGGGGTGGAAGG - Intergenic
1125509343 15:40284186-40284208 CTGGGTGTGGGTGGTGGGGAGGG + Intronic
1126435501 15:48633445-48633467 GTGAGTATGTGTGTGGTGGAGGG + Intronic
1127167856 15:56266473-56266495 CTGTCATTGGGTGGGGGGGATGG - Intronic
1127594149 15:60461092-60461114 CTAGGGATGGGTGGGGTGGGGGG + Intronic
1127682226 15:61309054-61309076 GTGTGAGTGTGTGGGGTGGAGGG + Intergenic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1129831847 15:78675828-78675850 GTGTGTATGGGTGGGGCTGGGGG + Intronic
1130530498 15:84744408-84744430 CTGTGGAGGGGTGGGATGGAAGG - Intergenic
1130875580 15:88011156-88011178 CTCTGGATGAGTGGGGTGGAAGG - Intronic
1130881965 15:88062986-88063008 GTGTGTGTGGGTGAGGGGGATGG - Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1132425786 15:101715575-101715597 ATATGTGTGCGTGGGGTGGATGG - Intronic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132550757 16:553055-553077 CTGTGCAGGGGTGGGGGGGCAGG - Intronic
1132710539 16:1264289-1264311 CTGTGAATGGGTGGGGGTGTGGG + Intergenic
1133104495 16:3498089-3498111 CTGGGTAGGGGTGGGGGTGAGGG + Intergenic
1133397300 16:5458360-5458382 CTGTGGATGGGTGGTGTAGCCGG + Intergenic
1133596082 16:7294132-7294154 CAGAGAGTGGGTGGGGTGGAGGG + Intronic
1133611814 16:7440707-7440729 CTGTTTAGGGCTGGGGAGGAGGG + Intronic
1133981100 16:10633861-10633883 ATGTGTTGGGGTGGGGTGGAGGG - Intronic
1134107429 16:11494319-11494341 CTGAGTGGGGGTGGGGTGAAGGG - Intronic
1134793881 16:17016507-17016529 GTGTGTGTGTGTGGTGTGGAGGG + Intergenic
1134890864 16:17840816-17840838 CTGCTTGTGAGTGGGGTGGATGG + Intergenic
1135933174 16:26756868-26756890 GTATGTGTGTGTGGGGTGGATGG + Intergenic
1136178927 16:28537917-28537939 GTGTGATTGGGTGGGGAGGAGGG - Intronic
1136243389 16:28958640-28958662 TTGTGTTTGGGTGGTGTGGCTGG + Intronic
1136316917 16:29459918-29459940 CTGAGTATGGGTGTGGTGTAGGG - Exonic
1136428557 16:30184465-30184487 CAGTGTCTGGGTGGGGAGCAAGG - Intronic
1136431492 16:30199260-30199282 CTGAGTATGGGTGTGGTGTAGGG - Intronic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136852522 16:33624349-33624371 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1136993511 16:35172187-35172209 CTGTGTGTGGGTGGGTGGGTGGG + Intergenic
1137289423 16:47041860-47041882 GAGTGTGTGGGCGGGGTGGAGGG - Intergenic
1137401191 16:48155720-48155742 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1137932552 16:52602857-52602879 GTGTGTATATGTGGGGTGGGGGG - Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138456340 16:57123184-57123206 CTGTGTATCTGTGGGGTGTGGGG + Intronic
1138587068 16:57977581-57977603 GTGTGTATGTGTGTGTTGGAAGG + Intronic
1139694107 16:68661050-68661072 AAGTGTATGTATGGGGTGGAGGG + Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1140866595 16:79067614-79067636 GTGCGTGTGGGTGGGGTGGGGGG + Intronic
1141229800 16:82155499-82155521 GTGTGTATGTATGGGGTGGAGGG - Intronic
1141286570 16:82678169-82678191 CTGTGTATTGGATGGATGGATGG + Intronic
1141483279 16:84321343-84321365 CCGTGGGTGGGTGGGGTGTATGG + Intronic
1203114122 16_KI270728v1_random:1472817-1472839 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1143188392 17:5024025-5024047 CTGGGTAGGGTTGGGGTGGCTGG - Exonic
1143469233 17:7161395-7161417 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1143654431 17:8285665-8285687 CTCTGAATGAATGGGGTGGAAGG - Intergenic
1143739967 17:8945339-8945361 GTGTGTGTGGCTGGGGTGGGAGG - Intronic
1143740665 17:8951329-8951351 CTGTGAATGGATGGTGGGGATGG - Intronic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144117072 17:12106250-12106272 CTGTGTCTGTTTTGGGTGGAGGG + Intronic
1144993325 17:19249157-19249179 CTGATTAGAGGTGGGGTGGAAGG - Intronic
1145768465 17:27475636-27475658 CCCTGTAAGGATGGGGTGGACGG - Intronic
1145939910 17:28737867-28737889 CAGTGTATGCCTGGGGTGGTGGG + Exonic
1145963538 17:28901453-28901475 CTGCGTGGGGGTGGGGTGGCGGG - Intronic
1148346063 17:46904322-46904344 GGGTGGATGGATGGGGTGGATGG + Intergenic
1148470699 17:47891413-47891435 CTGTCTGTCGGGGGGGTGGAGGG - Intergenic
1148804138 17:50255866-50255888 GAGGGTCTGGGTGGGGTGGAGGG - Intergenic
1148839186 17:50483824-50483846 ATGTGTGTGGGGGGGGTGGCAGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149547042 17:57511388-57511410 CTGGGTAAGTGTGGGGTGGGTGG - Intronic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1151210264 17:72539150-72539172 GTGTGTGTGGGTGTGGTGGGGGG - Intergenic
1151404407 17:73877453-73877475 CTGTGGATGGGAGGTGAGGAAGG - Intergenic
1151606108 17:75137341-75137363 TTGTGGAGGGGTGGGGTGGCAGG + Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152345374 17:79747916-79747938 CTGTGTCTGGGTGGGGGGATGGG - Intergenic
1152739039 17:82011128-82011150 CTGGGCATGGGTGGGGCAGAGGG + Intronic
1152851646 17:82639964-82639986 CTGTGTGTGGGTCGGGAGGGTGG + Intronic
1152902565 17:82951792-82951814 CTGAGGAGGGGTGGGGTGGGGGG + Intronic
1153497472 18:5714429-5714451 TGGTGTAGGGGTGGGGTGCAGGG - Intergenic
1154355187 18:13619490-13619512 GTGTGTGTGGGTGGGGGGGTGGG + Intronic
1155035241 18:22020377-22020399 CTGAGTATGGGTAGAGAGGAAGG - Intergenic
1155079156 18:22390374-22390396 CTGTTAGGGGGTGGGGTGGAGGG + Intergenic
1155307541 18:24493323-24493345 CTGTGTGTGGGCGGGGGGGGGGG - Intergenic
1155608924 18:27640784-27640806 CTGTGAATGGGATGGGAGGAGGG + Intergenic
1155665564 18:28304311-28304333 TTGTGTATGGAAGGGGTGTAAGG + Intergenic
1157774583 18:50382602-50382624 TCGTGAATGGGTGGGATGGAGGG - Intronic
1157946593 18:51987651-51987673 ATGGCTCTGGGTGGGGTGGAAGG - Intergenic
1158008511 18:52701429-52701451 CTGTCTATGGGTAGGAAGGAAGG - Intronic
1158440510 18:57470764-57470786 TTGTGTGTGTGTGGTGTGGAGGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159647835 18:70940769-70940791 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1159778366 18:72630538-72630560 GTGTGTGTGTGTGGGGGGGAGGG - Intronic
1160240391 18:77118577-77118599 GTGTGTGTGGGTGGGGCGGGTGG - Intronic
1160297288 18:77650274-77650296 GGGTGGATGGGTGGGGGGGATGG - Intergenic
1160451719 18:78971026-78971048 CTGGGGATGGGTGGCTTGGAGGG - Intergenic
1160744970 19:707014-707036 CTTTTTTTGGCTGGGGTGGACGG - Intergenic
1160908289 19:1462185-1462207 CTGTGTGCGGGTGGGGGGGTGGG - Intronic
1161091124 19:2360462-2360484 CTGTGTAGAGGTGGCGTGGCGGG + Intergenic
1161149671 19:2701429-2701451 TTGTGAGTGTGTGGGGTGGAAGG - Intronic
1161410954 19:4117214-4117236 CTGTGTGTGGCTGGTGTGGCTGG + Intronic
1161726029 19:5929575-5929597 CTGTGTGTGTGTGGGGCGGGAGG + Intronic
1161788073 19:6340572-6340594 CTGTGTGTGGGTGGAGCAGATGG + Intergenic
1161826083 19:6566711-6566733 CTTTTTATGGTTGGGATGGATGG - Intergenic
1162312865 19:9917523-9917545 CTGTGTCTGCTTGGGGTGGAGGG + Intronic
1162479731 19:10921303-10921325 CTGTGCATGGGCTGGGTGGCTGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163425830 19:17240560-17240582 CTGTGAAAGGGAGGGGTGAAAGG + Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163810930 19:19430949-19430971 TTGTGTTTGGGTGGGTTGTATGG + Intronic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164711039 19:30357396-30357418 GAGAGGATGGGTGGGGTGGAGGG + Intronic
1164783403 19:30911445-30911467 TTGTGTATGTGTGGGGTGTGGGG - Intergenic
1164940497 19:32249337-32249359 GAGTATCTGGGTGGGGTGGAGGG + Intergenic
1164941889 19:32257230-32257252 CTCTTTGTGGGTGGGGTGGCGGG - Intergenic
1164956400 19:32390519-32390541 CTGTGGTGGGGTGGGGTGGGAGG - Intergenic
1164995879 19:32720231-32720253 CTGTGTAGGGTTGGGGTCGGGGG - Intronic
1165104008 19:33457977-33457999 CTCTGTATGGGTTGGGGGGCGGG + Intronic
1165671957 19:37687335-37687357 CTCTGTAGGGGTGGGGGGCATGG - Intronic
1165804373 19:38571631-38571653 CTTTTTTTTGGTGGGGTGGACGG - Intronic
1166108661 19:40610046-40610068 CTGGGTAGGGGTGGGGTCAAAGG - Intronic
1166348346 19:42180615-42180637 CAGTACATGGGTGGGGTGGGGGG + Intronic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1166758665 19:45211352-45211374 CTGGGTATGGTGGTGGTGGAGGG + Intronic
1166781297 19:45344995-45345017 CTGGGGGTGGGTGGGGTGGGAGG - Intronic
1166803825 19:45473317-45473339 CTGGGGATGGGTGGGGAGGGGGG + Exonic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167440632 19:49506765-49506787 TTGTGTAAGGGTGGAGAGGAGGG + Intergenic
1167461312 19:49625957-49625979 CTATGTATGGCTGGGGGGGGTGG + Exonic
1168142921 19:54401373-54401395 GGGTGTCTGGGTGGTGTGGATGG - Intergenic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1168405487 19:56108272-56108294 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405514 19:56108341-56108363 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
924963720 2:57321-57343 CTGTGCAAGGGTAGGGTGCAGGG - Intergenic
925140666 2:1547853-1547875 CTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925440029 2:3877778-3877800 CGGTGTTTGGTTGGGGTGGGGGG - Intergenic
925955960 2:8964161-8964183 CTCTTTGTGGGAGGGGTGGAAGG - Intronic
925985132 2:9208339-9208361 GTGTGTGTGGGTGGGGGGGTGGG + Intronic
926165860 2:10521932-10521954 CTGTGACTGGGTGTGGGGGAGGG + Intergenic
926237172 2:11054692-11054714 AGGTGTGTGGGTGGGGTGGAGGG - Intergenic
926583817 2:14662970-14662992 CTGTGTTGGGGTGGGGAGGTGGG + Intergenic
926857588 2:17273541-17273563 GTGTGAAGGGGTGGGATGGAAGG - Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
927587115 2:24318023-24318045 CTATGTGTCAGTGGGGTGGAAGG - Intronic
928053673 2:28028404-28028426 CTGCGTGTGGGTGGCGGGGAGGG - Intronic
928195968 2:29216676-29216698 TTGTGTATATGTGGGGTGTATGG + Intronic
928245441 2:29622670-29622692 CTGGGTATTGGTGTGTTGGAAGG - Intronic
928301343 2:30127972-30127994 GTGTGTGTGGGTGGGGGGTATGG - Intergenic
928455156 2:31414019-31414041 CTGTGTGTGGGTGGGGAGTGGGG + Intronic
928467452 2:31535667-31535689 TTGTGATTGGGTGGGGTGGGAGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929041626 2:37750178-37750200 GTGTATATGTGTGGGGTGGGTGG - Intergenic
929771728 2:44897998-44898020 CTGTGTGTGGGTGTGGTATACGG - Intergenic
929952279 2:46422749-46422771 TTGTGTGTGGGTGTGGTGCAAGG - Intergenic
930027563 2:47038646-47038668 CTGTGTGTCGGGGGGGTGGGTGG - Intronic
930200739 2:48549882-48549904 CTGGGGGTGGGTGGGGTGGTGGG + Intronic
930274599 2:49296865-49296887 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
931115452 2:59162056-59162078 CTGTGGTGGGGTGGGGGGGAGGG - Intergenic
932239569 2:70146171-70146193 ATGTGTATGGGTGGGGAGGTAGG + Intergenic
932479691 2:72031754-72031776 ATGTGTATGAGTGGGCAGGAGGG - Intergenic
932483995 2:72069823-72069845 CTGTGGTGGGGTGGGGTGGGGGG + Intergenic
933684359 2:85132097-85132119 GTGTGTATGGGTGGGGGGAGGGG + Intergenic
934601457 2:95661736-95661758 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
934921484 2:98347847-98347869 GTGTGTATGTGTTGGGGGGAGGG - Intronic
935168624 2:100591797-100591819 GTGTGTATGTGTGGTGTGGTGGG + Intergenic
935493281 2:103746835-103746857 CTGTTTTGGGGTGGGGGGGAGGG - Intergenic
935592929 2:104857180-104857202 CTGTCTCTGGGTGGAGGGGAGGG - Exonic
935668454 2:105534970-105534992 CTGATTATGGATGAGGTGGAGGG - Intergenic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936534821 2:113303904-113303926 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
936551878 2:113450848-113450870 CTGTATATTGTTGGAGTGGAGGG + Intronic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
936820891 2:116519418-116519440 CTGGGGATGGGTGTGGTGGTGGG + Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937413829 2:121698736-121698758 CTGTGGATGGGTGGTGGTGATGG + Intergenic
937666512 2:124494100-124494122 GTGTGTGTGGGTGGGGGGGTAGG + Intronic
937914436 2:127092093-127092115 GGGTGTAGGGGTGTGGTGGAGGG - Intronic
938413393 2:131084192-131084214 CTGTCTTGGGGTGGGGTGGGGGG - Intronic
938866405 2:135426013-135426035 TTGTGTATGTGTGGGGTCAATGG - Intronic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941225882 2:162848136-162848158 CTCTGCTTGGGTGGTGTGGAAGG - Intergenic
941937585 2:170997368-170997390 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
942655176 2:178207716-178207738 CTGTGTTTGTCTGGGGAGGAGGG + Intronic
945048444 2:205801788-205801810 CTGTGTAGGAGAGGGGTTGAGGG - Intergenic
945780228 2:214161669-214161691 CTGTAGAGGGGTGGGGTTGATGG + Intronic
946100190 2:217313932-217313954 GTGTGTTTGGGAGGGGAGGAGGG + Intronic
946431960 2:219630915-219630937 CAGTGTGTGGGTGGGGTGGGGGG + Intronic
946570629 2:221020245-221020267 GTGGGAATGGGTGCGGTGGATGG + Intergenic
947732338 2:232438388-232438410 CTGTCTGGGGGAGGGGTGGAGGG - Intergenic
947753212 2:232543474-232543496 TTGAGGATGGGGGGGGTGGATGG - Intronic
948084838 2:235238809-235238831 CTGTGTGTGGGTGGGGCTGCTGG + Intergenic
948387600 2:237591286-237591308 CTGAGTATGGCTGGGGTAGCAGG + Intronic
948682326 2:239643867-239643889 GTGTGTATGTGTGGGGTGTGTGG + Intergenic
948720838 2:239899082-239899104 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948720875 2:239899209-239899231 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948763983 2:240210250-240210272 CTGAGTAGGGGCGGGGTGGCGGG - Intergenic
1168863057 20:1059953-1059975 CTTAGTATGAATGGGGTGGAGGG - Intergenic
1168870541 20:1123821-1123843 CTGTGTAGGTGTGGGGAGAATGG - Intronic
1169244971 20:4017938-4017960 CTATGTATGTGTAGGGGGGAAGG + Intergenic
1169645616 20:7806519-7806541 CTGTTCATGGGTGGGGTGCTAGG - Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1170093974 20:12624423-12624445 CTGTGTATGTGTGGGGGCGAGGG + Intergenic
1170247354 20:14237690-14237712 CTGTTTTGGGGTGGGGGGGAGGG - Intronic
1170524212 20:17221457-17221479 CTGAGGATGGGTGGTGTGAAGGG + Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171234550 20:23513578-23513600 ATGTGTGTGTGTGTGGTGGAGGG - Intergenic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1172425259 20:34851545-34851567 GCCTGGATGGGTGGGGTGGATGG + Intronic
1172897722 20:38312269-38312291 CTTGGGGTGGGTGGGGTGGAGGG - Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173586523 20:44187052-44187074 CAGTGAAAGGGTGGGGTGGAGGG + Exonic
1173617322 20:44411528-44411550 GTGTGGGCGGGTGGGGTGGACGG + Intronic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175296729 20:57913740-57913762 ATGTGCATGGGCAGGGTGGACGG + Intergenic
1175314932 20:58040537-58040559 ATGTGTGTGTGTGGGGTGGGGGG - Intergenic
1175526664 20:59639012-59639034 GGGTGGATGGGTGGGGTGGATGG + Intronic
1175678308 20:60966065-60966087 CGGTGTTTGGGTGGTGGGGATGG - Intergenic
1175862838 20:62159363-62159385 CTGGGTGTGGGTGGGGTGAAGGG + Intronic
1175932751 20:62500461-62500483 CTGTGTATGTGTGGGTGTGAGGG + Intergenic
1175932776 20:62500729-62500751 CTGTGTATGTGTGGGTGTGAGGG + Intergenic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176307812 21:5133384-5133406 CTGGGGGTGGGTGGGGTGCACGG - Intronic
1176428207 21:6561495-6561517 CTGTGGTTGGGTGGGGGGGGGGG - Intergenic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1177390512 21:20462653-20462675 GGGTTTATGAGTGGGGTGGATGG + Intergenic
1177810967 21:25924606-25924628 CTGTCCAGGGGTGGGGTGAAAGG + Intronic
1178293303 21:31387533-31387555 CTGTATATGGATGGTGTGCAGGG + Intronic
1179451913 21:41473669-41473691 CTGGGTCTGGGTGGGCTGGAGGG - Intronic
1179509261 21:41861660-41861682 CTGGGGATGAGCGGGGTGGAGGG - Exonic
1179703697 21:43169811-43169833 CTGTGGTTGGGTGGGGGGGGGGG - Intronic
1179849249 21:44128646-44128668 CTGGGGGTGGGTGGGGTGCACGG + Intronic
1179955726 21:44737171-44737193 CAGGGGAGGGGTGGGGTGGAGGG + Intergenic
1180096749 21:45559048-45559070 CTTTGGATGGCTGAGGTGGATGG - Intergenic
1180101952 21:45592081-45592103 TTGTGTGTGGGTGGTGTGCATGG - Intergenic
1180112153 21:45664764-45664786 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
1181046879 22:20219094-20219116 CTGTGGATGGATGGGGGTGATGG - Intergenic
1181185895 22:21103401-21103423 CTTTTTCTGGGTGGGGGGGAGGG + Intergenic
1181478648 22:23183543-23183565 CTATGTGGGGGCGGGGTGGAAGG + Intronic
1182601574 22:31469121-31469143 CTGTGTAATGATGGGGTGGTGGG + Intronic
1182673635 22:32019212-32019234 CTGTGGATGGGTGGTGGAGATGG - Intergenic
1182691227 22:32164839-32164861 CTGTGTCTGGATGGAGGGGAGGG + Intergenic
1183866723 22:40710195-40710217 CTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1184147287 22:42619131-42619153 CAGTGTTTGGATGGGCTGGAAGG + Exonic
1184281072 22:43437831-43437853 CTGGGTAGGGGTGGGGTGTTGGG + Intronic
1184322783 22:43755716-43755738 CTGACAATGGGTGGGGTGGGGGG + Intronic
1184852300 22:47127965-47127987 GGGGGGATGGGTGGGGTGGAGGG - Intronic
1184852314 22:47127993-47128015 GGGGGGATGGGTGGGGTGGAGGG - Intronic
1184852328 22:47128021-47128043 GAGAGGATGGGTGGGGTGGAGGG - Intronic
1184852367 22:47128115-47128137 TGGGGGATGGGTGGGGTGGAGGG - Intronic
1184852380 22:47128142-47128164 TGGGGGATGGGTGGGGTGGAGGG - Intronic
1184852393 22:47128169-47128191 TGGGGGATGGGTGGGGTGGAGGG - Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1185013861 22:48332219-48332241 GTGTGTGTGGGTGGGGTCTATGG - Intergenic
950160607 3:10757934-10757956 CTGGGTCTGGGAGGGGTGGAAGG + Intergenic
952091261 3:29889246-29889268 ATGTGTATGTGTGTGGTGGTGGG - Intronic
952127699 3:30321163-30321185 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
952306776 3:32153836-32153858 CTGAATAGGGGTGGGTTGGATGG - Intronic
952893459 3:38060348-38060370 CTGAGAATGAGTGGGGTGGGAGG + Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
954137464 3:48588595-48588617 CTTCGGATGGGTGGTGTGGATGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954794415 3:53154284-53154306 CTTGGTGTGGGTGGGGTGGGAGG + Intergenic
954798373 3:53172907-53172929 CAGGGAAGGGGTGGGGTGGAGGG + Intronic
954854086 3:53627603-53627625 CTGTGGATGGGTGGGGGGTGGGG + Intronic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
955475186 3:59329126-59329148 CTGTGGATGGATGAGGTGGTAGG - Intergenic
955537139 3:59935637-59935659 GGATGGATGGGTGGGGTGGATGG + Intronic
955750310 3:62179900-62179922 CTGAGTGTGGGTGGAGTGGTAGG - Intronic
956897770 3:73681369-73681391 CTGTGTTGGGGTGGGGTGAGAGG - Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957150089 3:76475577-76475599 ATGTGTATGGGTGGGGGAGGGGG + Intronic
957698760 3:83681097-83681119 CAGTGTAGGGGTGGGGTGGAGGG + Intergenic
957851391 3:85812125-85812147 CTATATATGGGTGTGGTGGAAGG + Intronic
959396595 3:105847385-105847407 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
960253835 3:115488975-115488997 ATGTGTATGTGTTGGGTGGCAGG + Intergenic
960781445 3:121322669-121322691 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
961043327 3:123692697-123692719 CTGTGTATGGGTGGCGGCGATGG + Intronic
961447464 3:126987611-126987633 CTGTGGAGGGGTGGAGTGCAGGG + Intergenic
961611818 3:128145548-128145570 GAGTGTTGGGGTGGGGTGGATGG + Intronic
961705199 3:128779578-128779600 GTGTGTTGGGGTGGGGTGGGGGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962322827 3:134405961-134405983 GTGTGTATGGGCGGGGGGGTGGG + Intergenic
962833612 3:139166625-139166647 CTGTCATGGGGTGGGGTGGAGGG - Intronic
963619914 3:147593978-147594000 CTGTTAATGGGTGGGGGGGTGGG - Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
964645821 3:158957440-158957462 CTGTGGTGGGGTGGGGGGGAGGG - Intergenic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965450526 3:168832875-168832897 CTGGGCCAGGGTGGGGTGGATGG - Intergenic
965764110 3:172111613-172111635 CTTTTTTTGGGTGGGATGGAGGG + Intronic
966062901 3:175781852-175781874 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
966766089 3:183463874-183463896 ATGTGCATGTGTGGGGTGGGGGG + Intergenic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
968057291 3:195701969-195701991 CTGTGGGTGGCTGGGGTGGACGG + Intergenic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
968768074 4:2485053-2485075 ATGTATGTGGGTGGGGTGGGCGG - Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969840854 4:9880636-9880658 GTGTGCATGGGTGGGGAAGAAGG + Intronic
970240864 4:14007501-14007523 ATGTGTGGGGGTGGGGTGGGGGG - Intergenic
970416254 4:15860222-15860244 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
970828079 4:20302460-20302482 ATGTCTATGGGGGGGATGGAAGG + Intronic
972278562 4:37581970-37581992 CTGTGTGTGGGTAGGCTGGGGGG + Intronic
972718534 4:41673353-41673375 CTGGGTAGGGGTGGAGAGGAAGG + Intronic
972971630 4:44583215-44583237 CTATGTATGCGTGTGGTGGGGGG - Intergenic
972973105 4:44601859-44601881 GTGTGTGTGGGTGGTGGGGAGGG - Intergenic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973585655 4:52388337-52388359 CTGTCGAGGGGTGGGGTGGGGGG - Intergenic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
975028108 4:69576777-69576799 CTGTGTAGCGGTGGGCTGAAGGG + Intergenic
975337457 4:73195872-73195894 GTGTATATGGGTGGGATGGGAGG + Intronic
975804609 4:78098947-78098969 CTTTTTATGGGTGGGATGGCAGG + Intronic
976512888 4:85931235-85931257 CTGTGAATAGGTGGGGTAGGTGG + Intronic
976686225 4:87818739-87818761 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
976742295 4:88368671-88368693 CTGTGTATGTGTGGTGGGGTGGG + Intergenic
976963996 4:91012503-91012525 CTGTGTCTGGGTGGGGAGGGTGG + Intronic
978107008 4:104915656-104915678 CTGTGTATGTGTTGAGGGGAAGG - Intergenic
979215274 4:118156153-118156175 TTCTGTATGGGTGGAGTGAAAGG - Intronic
979473377 4:121126656-121126678 CCGTGTGTGGCTGTGGTGGATGG + Intergenic
979522164 4:121680048-121680070 GGGTGTAGGGGTGGGGTGAATGG - Intronic
979531364 4:121772274-121772296 CTGTATATGGCAGGGATGGAGGG - Intergenic
979696192 4:123616009-123616031 CTGTGAATGGGTAGGTTTGAAGG - Intergenic
980282693 4:130740767-130740789 TTGTGTATGGGTGGGTGGGTGGG + Intergenic
980599007 4:134994607-134994629 CTGTCAAGGGGTGGGGTGGTAGG + Intergenic
980849639 4:138365497-138365519 TTGGGTATGGTTGGGTTGGAGGG + Intergenic
980986093 4:139695878-139695900 CTGTGTGTGTGTGGGGCGGGGGG - Intronic
981746683 4:148058951-148058973 CTGTGTTTAGGTGGGGTGGGTGG - Intronic
981875773 4:149543571-149543593 GTGTATATGTGTGGGGTGGGGGG + Intergenic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
983536242 4:168860288-168860310 CTGTGCATGGCTGTGGTTGAGGG - Intronic
983622710 4:169776687-169776709 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
984117828 4:175704355-175704377 TTGTGTGTGTGTGGGGTGGGGGG - Intronic
984466009 4:180101068-180101090 CTGTGTTTCCCTGGGGTGGATGG - Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
985117711 4:186607592-186607614 AGATGGATGGGTGGGGTGGATGG + Intronic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985728854 5:1533298-1533320 ATGTGTAGGGGTGGGATGTAGGG - Intergenic
985764280 5:1768631-1768653 GGGTGTGTGGGTGGGGTTGAGGG + Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985808436 5:2065787-2065809 CTGGGTGTGGGTGGGAGGGAGGG - Intergenic
986248392 5:6031895-6031917 CTGCATATGGGTGGTGAGGACGG + Intergenic
986994148 5:13586943-13586965 CTGTCAGGGGGTGGGGTGGAGGG - Intergenic
988098606 5:26649670-26649692 CTGTGTATAGGTGGGGTGGAGGG - Intergenic
988549379 5:32186338-32186360 CTTTGTGAGGCTGGGGTGGAAGG + Intergenic
988659745 5:33252440-33252462 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
988675360 5:33427850-33427872 CTGGCTATGGGAGGGGAGGATGG + Intergenic
988971334 5:36471276-36471298 CTGTCAAGGGGTGGGGTGGAAGG + Intergenic
989356663 5:40551320-40551342 GTGTGTGTGGGTGGGGGGGTGGG - Intergenic
990442908 5:55864607-55864629 CTGTGTGTGTGTGGTGTGTATGG - Intronic
991449166 5:66733313-66733335 CTGTGCATGTGTGTGGTGGGGGG - Intronic
992147772 5:73869206-73869228 GAGTGTGTGTGTGGGGTGGAGGG + Intronic
992299522 5:75364007-75364029 CTGTGTGTGTGTGTGTTGGAAGG + Intergenic
992728320 5:79631825-79631847 CTGTGTATAGGTGGAGTGATTGG + Intronic
992832764 5:80610970-80610992 CTGTGTATGGGAGGGGAGGCCGG - Intergenic
992914081 5:81430729-81430751 GTGTGTATGTGTGGTGGGGACGG + Intronic
993106397 5:83605584-83605606 CTGTGTTTGGTTGGGGTGGGTGG + Intergenic
993357349 5:86930759-86930781 TTGTGTATGTGTTGGGCGGAGGG + Intergenic
993924241 5:93845749-93845771 CTGTGTCTGTGTGTGTTGGAGGG + Intronic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
994141010 5:96341333-96341355 GGGTGGAGGGGTGGGGTGGAGGG - Intergenic
995081840 5:108060715-108060737 TTGTGTGTGGGAGGGGGGGATGG - Intronic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996408033 5:123125994-123126016 GTGTGTGTGGGTGGGTTGGGGGG + Intronic
996476285 5:123925936-123925958 CTGTGAATGTGTGGGGTGCCTGG + Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996952109 5:129139785-129139807 CTGTTTTTGGGTGGGGTGAGGGG - Intergenic
996954827 5:129170242-129170264 CAGAATATGGGTGGAGTGGAGGG - Intergenic
997027385 5:130081317-130081339 GTGTGTGTTGGTGGGGTGGGTGG + Intronic
997201620 5:132013226-132013248 GAGTGTATGGGTGGGGTGGGGGG - Intergenic
997717391 5:136052248-136052270 CTATTTATGGGTGTGGTGAATGG + Intronic
998094667 5:139390505-139390527 CTGGGTATGGCCTGGGTGGAGGG - Intergenic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998383470 5:141742328-141742350 CTGAGGCTGGGTGGGGTGGGGGG + Intergenic
998454181 5:142258174-142258196 AAGTGGATGGGTTGGGTGGATGG - Intergenic
999764578 5:154729607-154729629 GTGTGTTTGGGTGGAGTGGCTGG - Intronic
999785095 5:154883599-154883621 CTGGGTTTGGAAGGGGTGGATGG - Intergenic
1000107353 5:158072887-158072909 CTGTGTGTGGGTGTGGTGGGGGG + Intergenic
1000848042 5:166305623-166305645 CTGAGAAAGGGTGGGGAGGATGG - Intergenic
1001198193 5:169692518-169692540 GTGTGTGGGGGTGGGGTGGCGGG + Intronic
1001419199 5:171573957-171573979 CTGGGTCTGTGTGGGGTGGCCGG + Intergenic
1001675089 5:173505383-173505405 GTGTGTGTGGGAGGGGTGGGTGG + Intergenic
1001698581 5:173690543-173690565 GTGAGGATGGGTGGGGTGGCAGG - Intergenic
1002427952 5:179186837-179186859 GTGTGTGTGGGTGGGGGGGTGGG - Intronic
1002618617 5:180470606-180470628 CTGTGCATGGATGGGGCGGGAGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1002946520 6:1766552-1766574 TTGTGTATGGCTCGGGAGGAGGG + Intronic
1002978214 6:2107702-2107724 CTGTGAATAGGTGATGTGGATGG - Intronic
1003005351 6:2376111-2376133 CTGTGTGTGTGTTGGGTGTAGGG - Intergenic
1003325641 6:5087810-5087832 CTGTGCATGGGTGGGCAGGAGGG + Exonic
1003532302 6:6947955-6947977 CTGTGAAGAGGTGGGGTGGCGGG - Intergenic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004091693 6:12509262-12509284 AATTGTAGGGGTGGGGTGGAAGG + Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004271795 6:14202210-14202232 CTCTGCGTGTGTGGGGTGGAGGG - Intergenic
1004662334 6:17721537-17721559 CTATGTATGTGTGTGGTGGGTGG + Intergenic
1005025384 6:21458123-21458145 CTTTGCATGGGTGGCGTGCACGG - Intergenic
1005154275 6:22785766-22785788 CTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005396365 6:25386246-25386268 TTGTGTGTGTGTGGGGTGGGTGG + Intronic
1005629564 6:27694518-27694540 CTGTTGATGGGTTGGGTGCAGGG + Intergenic
1005823047 6:29613520-29613542 ATGTGTGTGGGTGTGGGGGAAGG + Intronic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006710583 6:36065749-36065771 ATGTGTTTGTGTGGGGAGGAAGG - Intronic
1006755171 6:36409394-36409416 CTGCGTCTTGGTGGGGTAGATGG - Intronic
1006795712 6:36731124-36731146 GTGTGTAGGGGTGGGGGAGATGG - Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007402575 6:41611994-41612016 CTGTGCATGTGTGGGGTAGGGGG + Intergenic
1007518724 6:42434661-42434683 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1007553276 6:42746280-42746302 TTGTGGATGGGTGGGGTGGGAGG + Intergenic
1007769838 6:44183812-44183834 CTGGGTGGGGGTGGGGTTGAGGG - Intronic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1008107188 6:47451717-47451739 CTGGGGTGGGGTGGGGTGGAAGG - Intergenic
1008919574 6:56827934-56827956 CTGTGTATGTGTGTGGGGGTGGG - Intronic
1008983551 6:57514856-57514878 ATGTGTGTGGGTGGGGAGGGGGG - Intronic
1009711341 6:67325502-67325524 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1009826786 6:68876268-68876290 CTGTGTCTTGGTGGGATAGATGG + Intronic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1009960572 6:70515840-70515862 ATGTGTAGGGGTGGGGAAGAGGG + Intronic
1011290166 6:85768680-85768702 CTTTGGATGGGTGAGGTGGGAGG + Intergenic
1011311525 6:85985067-85985089 CTGTGGTGGGGTGGGGTGGGGGG - Intergenic
1011350943 6:86423225-86423247 ATGTGTATGTATGGGGTTGAGGG + Intergenic
1011472636 6:87723192-87723214 CAGTATATGGGTAGGGAGGAGGG - Intergenic
1011821228 6:91255911-91255933 CTGTGCTGGGGTGGTGTGGAAGG + Intergenic
1011881814 6:92037784-92037806 CTGTGTATGGTTTCGGTGAAGGG - Intergenic
1012058642 6:94448301-94448323 CATTATATGGGTGGGGTGGGGGG + Intergenic
1012547260 6:100433727-100433749 GTGTGTGTGGGTGGGGGGGTGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013339624 6:109200860-109200882 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1013729305 6:113144636-113144658 CTATGGATGGGTGGGGAGGTGGG - Intergenic
1013929115 6:115508977-115508999 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1014671952 6:124315250-124315272 ATGTGTCTGGGAGGGTTGGATGG - Intronic
1016403327 6:143704109-143704131 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1016762035 6:147748243-147748265 CTTGGTATGTGTGTGGTGGAAGG + Intergenic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1017048898 6:150372311-150372333 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048926 6:150372437-150372459 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017447354 6:154518789-154518811 CTGTGGGGGGGTGGGGTGGGGGG - Intergenic
1017488097 6:154921295-154921317 CTGGGTATGTGTGAGGGGGAGGG - Intronic
1017587913 6:155947196-155947218 CTGAGCATGGGTGGGGGGCAAGG + Intergenic
1017634523 6:156430872-156430894 GGGTGGAGGGGTGGGGTGGATGG + Intergenic
1018099884 6:160428076-160428098 GTGTGTGTGGGTGGGGGGGTGGG - Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018678148 6:166241052-166241074 CTGTGTATTGAAGGGGTGGCTGG - Intergenic
1018865998 6:167747628-167747650 CTGTGGAAGGGAGGGGGGGAGGG + Intergenic
1019001917 6:168761068-168761090 TTGTGTATGTGTGGGGCGGGCGG + Intergenic
1019552046 7:1608059-1608081 CTGTGTGTGCGAGGCGTGGAGGG + Intergenic
1020652710 7:10894611-10894633 TGGTGTATGTGTGGGGTGGCAGG - Intergenic
1020770109 7:12379947-12379969 CTGCGTGTGGGTGTGGTGGCGGG + Intronic
1020834113 7:13127135-13127157 CAGTCTGTGGGTTGGGTGGAGGG + Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1021568299 7:22036662-22036684 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1021594503 7:22300849-22300871 GTGTGATGGGGTGGGGTGGATGG - Intronic
1021708934 7:23396005-23396027 TTGTGTAGGGGTGGGGTAGGGGG - Intronic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022420825 7:30221750-30221772 CTGTGCATGGTGGGGGTAGAGGG + Intergenic
1023558597 7:41449149-41449171 GTGTGTATGGGTTGGGGGGCTGG + Intergenic
1023847069 7:44128363-44128385 CTATGTATGGGTTTGGTGGGAGG - Intergenic
1025839847 7:65136188-65136210 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1025883219 7:65559777-65559799 CTGTCTTGGGGTGGGGTGGGGGG + Intergenic
1025890227 7:65642829-65642851 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1026390697 7:69898648-69898670 CTGTGTGTGGTTGGGGATGAGGG - Intronic
1026508572 7:71007816-71007838 CTGTGTATGGTTGGGCAGGTTGG + Intergenic
1026890517 7:73979088-73979110 CTCAGAATGGGTGGGGTGCAGGG - Intergenic
1029345588 7:99976255-99976277 TTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1030927540 7:115477066-115477088 GTGTGGGGGGGTGGGGTGGAGGG + Intergenic
1031053120 7:116965400-116965422 CTGTGGAAGGGTGGGGGGCAAGG + Intronic
1031120577 7:117716953-117716975 CTGTGTGTGGGTGGGAAGGTGGG - Intronic
1031623028 7:123958582-123958604 CTGTGGAAGGATGGGGTGGGAGG + Intronic
1031660387 7:124416937-124416959 ATGTGTATGGGTGGGGGGTGAGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1032086680 7:128887372-128887394 CTGTGTATGTGTGGAGGGGGAGG - Intronic
1032425129 7:131816455-131816477 ATGTGTATGGGATGGGTGGGTGG + Intergenic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033615966 7:143014327-143014349 CTGTGTATGAATCGGGTAGAAGG + Intergenic
1034059340 7:148072069-148072091 AAGTATATGTGTGGGGTGGAAGG - Intronic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034440861 7:151085571-151085593 GTGTGTGTTGGTGGGGGGGAGGG + Intergenic
1034644697 7:152634762-152634784 GGGTGGGTGGGTGGGGTGGATGG - Intergenic
1035049070 7:155988068-155988090 CTTTGTCTGGGTGGGCTGGGTGG + Intergenic
1035324788 7:158057959-158057981 CTGTATATGGGTTGTGAGGAGGG - Intronic
1035381967 7:158446105-158446127 CTGTGTGTTGGTGGGCTGGGTGG - Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1038014875 8:23506107-23506129 CTGTATTTGGGAGGGGTGGCCGG + Intergenic
1038300832 8:26346082-26346104 CTGTGAATGGGTGGGGAAGGTGG - Intronic
1038325162 8:26567396-26567418 TAGTAGATGGGTGGGGTGGATGG - Intronic
1038480516 8:27898683-27898705 CTGAGTTTGGGTGGGATCGAAGG + Intronic
1038490811 8:27969737-27969759 CTGTGCATGGGAAGGGTGGCAGG + Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039411575 8:37359588-37359610 CTCTGGAAGGGTGTGGTGGATGG - Intergenic
1039593371 8:38769233-38769255 CTGTGTATGGGTTGGGGGTGTGG + Intronic
1039593444 8:38769770-38769792 CTGTGTATGGGTTGGGGGTGTGG + Intronic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1040848635 8:51874321-51874343 CGGGGGATGGGTGGGGTGGTGGG - Intronic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042581550 8:70284687-70284709 GTGTGTGTGGGTGTGGTGTACGG + Intronic
1042590513 8:70393528-70393550 GTGTGTATGGGTGGGGGTGGAGG - Intronic
1042743361 8:72075896-72075918 GTGTGTGTGTGTTGGGTGGAGGG + Intronic
1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG + Intergenic
1043789644 8:84448183-84448205 GTGTGGAAGGGTGGGCTGGAGGG - Intronic
1043958151 8:86386478-86386500 GTGTGTTTGGGTGGGGGGGCGGG + Intronic
1044071390 8:87764532-87764554 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1044646494 8:94449193-94449215 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047712110 8:127562839-127562861 CTGTTGTGGGGTGGGGTGGAGGG - Intergenic
1048254211 8:132893525-132893547 GTGTGTATGTGTGTGGTGTAGGG + Intronic
1048295732 8:133212145-133212167 GTGTGTATGTGTTGGGTGGGGGG + Intronic
1048974652 8:139664404-139664426 CTGTGTAGGGGAGGGGAGGCGGG - Intronic
1049133297 8:140869117-140869139 GTGTGTATGGGTTGGGGGGGCGG - Intronic
1049159597 8:141088900-141088922 CTGGGTACATGTGGGGTGGATGG + Intergenic
1049320365 8:141993009-141993031 CTGTGCATATGTGGGGTGGAAGG - Intergenic
1049620164 8:143594565-143594587 CTGTGATGGGGTGGCGTGGAGGG - Intronic
1049656325 8:143800033-143800055 CAGAGCATGGGTGGGGTGGGGGG - Intronic
1049901123 9:166306-166328 CTGTATATTGTTGGAGTGGAGGG - Intronic
1050015592 9:1229732-1229754 CTGTGGTGGGGTGGGGGGGATGG + Intergenic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050438518 9:5634905-5634927 CTGTGTATTTGTGGGGTATATGG + Intronic
1050620861 9:7450563-7450585 CTGTGTATGTGTGTGGTTGGGGG + Intergenic
1050727856 9:8672839-8672861 CTCTGTGTGGGGGGGGTGGGTGG + Intronic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051329862 9:16012831-16012853 CTGTGCATGGGTGGAGAGGGTGG + Intronic
1051545153 9:18265340-18265362 CTGGCTATGGGTGGGGTGATGGG - Intergenic
1051608861 9:18942426-18942448 CAGTGAAGGGGTTGGGTGGAAGG - Intronic
1051765984 9:20524205-20524227 CTGTGCATGTGTGGGGTTGGGGG + Intronic
1052328877 9:27246952-27246974 TTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1053744162 9:41176621-41176643 CTGTATATTGTTGGAGTGGAGGG - Intronic
1054349437 9:64006424-64006446 CTGTATATTGTTGGAGTGGAGGG - Intergenic
1054483112 9:65688676-65688698 CTGTATATTGTTGGAGTGGAGGG + Intronic
1054684182 9:68254632-68254654 CTGTATATTGTTGGAGTGGAGGG + Intronic
1055166433 9:73201022-73201044 ATGTGTATGTGTGTGTTGGAAGG - Intergenic
1055329929 9:75173221-75173243 CAGTGTATGGGTGGCATAGATGG + Intergenic
1055433422 9:76268272-76268294 GTGCGTATGTGTGGGGTGGGTGG - Intronic
1055955127 9:81766184-81766206 CTGTGGAGTGATGGGGTGGAAGG + Intergenic
1056048685 9:82745685-82745707 GTGTGTATTGGTGGGCTGGGTGG + Intergenic
1056291440 9:85147874-85147896 CTGTGTGTGGGTGGGTGGGTAGG - Intergenic
1056781073 9:89551539-89551561 CTGTGTGTGCGTGGGGTGGGGGG - Intergenic
1056910291 9:90693988-90694010 GTGTGTATGGGTGGTGTGTGGGG + Intergenic
1058847213 9:108972842-108972864 GTGTGTGTGGGTGGGGGGGTGGG + Intronic
1058969336 9:110065630-110065652 CTGTGAATGGATGGTGGGGACGG - Intronic
1059206242 9:112468881-112468903 ATGTGTGTGAGTGGGGTGGGTGG + Intronic
1059521125 9:114943234-114943256 GTGTGTATGTGTGGGAGGGAGGG + Intergenic
1059664776 9:116436313-116436335 TTGGGATTGGGTGGGGTGGAGGG + Intronic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1059780216 9:117518286-117518308 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
1060040167 9:120293482-120293504 GGGTGGATGGGTGGGGTGGTAGG + Intergenic
1060196661 9:121628458-121628480 CTGGCTATGGGTGTGGTGGTTGG + Intronic
1060907178 9:127317123-127317145 CTGTTCCTGGGTGGTGTGGACGG + Intronic
1061393446 9:130330398-130330420 CTGTAGGTGGTTGGGGTGGATGG + Intronic
1061760242 9:132846258-132846280 CAATGGATGTGTGGGGTGGATGG + Intronic
1061772189 9:132934211-132934233 CTGTGTATAGGAAGGGTGTAGGG - Intronic
1061878966 9:133559066-133559088 GTCTCCATGGGTGGGGTGGAGGG + Intronic
1062012153 9:134273025-134273047 CTCTGCATGGGAGGGCTGGAGGG + Intergenic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1203365024 Un_KI270442v1:249116-249138 CTGTGTGGGGGTGCGGGGGAAGG - Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1187108452 X:16269847-16269869 CTGTCGGTGGGTGGGGTGGGGGG - Intergenic
1187648166 X:21373151-21373173 GTGTGTGTGTGTGGGGGGGAAGG + Intergenic
1189261033 X:39678997-39679019 CAGTGTATGGGGCGGGTGGGGGG - Intergenic
1189364995 X:40381200-40381222 CAGGGTATGGGAGAGGTGGAGGG - Intergenic
1189375289 X:40461745-40461767 CTGTGTGTGGTTGTGGTGGGTGG - Intergenic
1189975838 X:46460768-46460790 CTGTGGCTGGGTGTGGTGGCTGG - Intronic
1189983229 X:46530932-46530954 CTGTGGCTGGGTGTGGTGGCTGG + Intronic
1190215389 X:48476504-48476526 CTGTGTATGGTTCGGGCGGCTGG + Intronic
1190630899 X:52384847-52384869 CTGTTGTTGGGTGGGGAGGAGGG + Intergenic
1192783982 X:74320437-74320459 CTATGTATGGGGGTGGTGGTGGG - Intergenic
1192884443 X:75321987-75322009 CTGAGAAGGGGTAGGGTGGAAGG - Intergenic
1193400165 X:81032817-81032839 CTGTTTTGGGGTGGGGGGGATGG + Intergenic
1193685098 X:84568156-84568178 GTGTGTGTGGGAGGGGTGGGGGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194235677 X:91380816-91380838 CTGTGTGTGCGTGGGGGGGGGGG - Intergenic
1194600424 X:95913816-95913838 GTGTGTGTGGGTGGGGGGGCGGG - Intergenic
1195510021 X:105704776-105704798 CTGTTGGTGGGTGGGGTGGTGGG - Intronic
1195545257 X:106106292-106106314 CTCTGTTAGGGTGGTGTGGAAGG + Intergenic
1195649489 X:107270353-107270375 CTGTGGTGGGGTGGGGTGGGGGG - Intergenic
1195709551 X:107763204-107763226 AAGTTTAAGGGTGGGGTGGAAGG - Intronic
1196760187 X:119193956-119193978 CGGTTTTTGGGTGGGGTGGGGGG - Intergenic
1197276933 X:124490226-124490248 ATGTCTTTGGGTGAGGTGGAGGG + Intronic
1197644790 X:129005724-129005746 GTGTGTGTGGGTGGGGCGGGGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198277859 X:135113140-135113162 CTGTGGATGTTTGGGCTGGAAGG - Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198472327 X:136959094-136959116 TTGTGTATGTGGGGAGTGGAAGG - Intergenic
1198602071 X:138294891-138294913 TTGTGTGTGTGTGGTGTGGAGGG - Intergenic
1199053968 X:143270575-143270597 CTCTGTTTGGGTTGGGGGGAGGG - Intergenic
1199892021 X:152094440-152094462 CTGGGGGTGGGTGGGGTGGGTGG + Intergenic
1200056012 X:153461403-153461425 CTGTGTATGTGTGGGGCAGGGGG + Intronic
1200222758 X:154399643-154399665 GTGTATGTGGGTGGGGTTGAGGG - Intronic
1201221673 Y:11777043-11777065 CTGTGTATGTGTGGGGACAAGGG + Intergenic
1201727620 Y:17170981-17171003 ATGTGCATGGGCGGGATGGATGG + Intergenic
1201764619 Y:17565856-17565878 CGGTGTATGTGTCGGGAGGAGGG - Intergenic
1201836934 Y:18340134-18340156 CGGTGTATGTGTCGGGAGGAGGG + Intergenic
1202345926 Y:23926878-23926900 GTGTGTATGTGTGGGGGGGTGGG + Intergenic
1202524845 Y:25743212-25743234 GTGTGTATGTGTGGGGGGGTGGG - Intergenic