ID: 1186442379

View in Genome Browser
Species Human (GRCh38)
Location X:9597311-9597333
Sequence CTGGGTTTAAGGAGAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186442379_1186442384 10 Left 1186442379 X:9597311-9597333 CCTGCTGCTCTCCTTAAACCCAG 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1186442384 X:9597344-9597366 ACTGCTTTATTTTAGAGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 392
1186442379_1186442385 18 Left 1186442379 X:9597311-9597333 CCTGCTGCTCTCCTTAAACCCAG 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1186442385 X:9597352-9597374 ATTTTAGAGAGTGGGTGTAGTGG 0: 1
1: 0
2: 4
3: 20
4: 302
1186442379_1186442383 9 Left 1186442379 X:9597311-9597333 CCTGCTGCTCTCCTTAAACCCAG 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1186442383 X:9597343-9597365 CACTGCTTTATTTTAGAGAGTGG 0: 1
1: 0
2: 0
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186442379 Original CRISPR CTGGGTTTAAGGAGAGCAGC AGG (reversed) Intronic
900283951 1:1890600-1890622 CGGGGTCTAGGGAGAGGAGCCGG - Intronic
901931212 1:12596927-12596949 CTGGGTTTATTGTGAGAAGCCGG + Intronic
902449642 1:16488741-16488763 TAGGGTTGAAGCAGAGCAGCAGG - Intergenic
902504840 1:16932601-16932623 TAGGGTTGAAGCAGAGCAGCAGG + Intronic
903232542 1:21930917-21930939 CTGGGTTTTAGGGGAGTATCTGG - Intronic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
906700626 1:47855316-47855338 CTGGGATTAAGGAGAGGAAAGGG - Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913355464 1:117916545-117916567 ATGGATGTAAGGAGACCAGCTGG + Intronic
914736866 1:150426175-150426197 CTGGGATTCAGGAGAGCTGGTGG - Intronic
915110492 1:153561707-153561729 CTGGGTATAAGGTGGGCAGGAGG + Intronic
918284688 1:183040628-183040650 CTGGGTTTCAGGAGAAAGGCTGG + Intronic
920949154 1:210556466-210556488 CTGGGGTTCAGGTGAGCAGCAGG - Intronic
923259104 1:232249824-232249846 GTGGGATGAAGGAGATCAGCAGG - Intergenic
1063232648 10:4080870-4080892 CTGGGTTGAAGGAGGTCATCAGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1065716870 10:28579001-28579023 CTTGGTTTAGGGAGAAGAGCAGG - Intronic
1067828412 10:49596081-49596103 CTGGGTCTAAAGGGATCAGCGGG + Intergenic
1069869833 10:71526366-71526388 CTGGGTCCAAGGTGAGCAGAGGG + Intronic
1070157864 10:73847272-73847294 CTGGGTTTATGGTCAGCATCTGG + Exonic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075268316 10:121025549-121025571 GTGGGTGTAAGGAGGGGAGCAGG + Intergenic
1075682703 10:124343851-124343873 CTGGTTTGGACGAGAGCAGCAGG + Intergenic
1076189472 10:128472757-128472779 TTGGGATTAAGCAGAGCAACGGG + Intergenic
1076253075 10:128998074-128998096 CTGGGTTCCAGGAGAACAGCAGG - Intergenic
1076556725 10:131328025-131328047 CTGGGGTTAAGGAGGGCATGGGG - Intergenic
1077301403 11:1848814-1848836 CTGGATTTGAGGGGAGAAGCCGG - Intergenic
1077597560 11:3547049-3547071 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1078544179 11:12234898-12234920 CTGGGTTTGAGGTGAGCAGGTGG + Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1080186496 11:29493542-29493564 CTGGGTTAAACGAGAGAACCAGG - Intergenic
1081445931 11:43131568-43131590 CTGGGTCTAAGGATAGGAGGAGG - Intergenic
1081662941 11:44899538-44899560 CTGGTGTCTAGGAGAGCAGCTGG + Intronic
1082745894 11:56962594-56962616 GTGGGTGTAAGGAGAACATCAGG - Intergenic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084915694 11:72427245-72427267 CTGGGGCTAAGGACAGGAGCTGG + Intronic
1085134416 11:74072992-74073014 CTGGGTCTGAAGAGAGGAGCTGG + Intronic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1086698255 11:89868996-89869018 TTGGCTTTAAGGAAAGCACCTGG - Intergenic
1086707909 11:89975492-89975514 TTGGCTTTAAGGAAAGCACCTGG + Intergenic
1086902426 11:92382972-92382994 CTGGGGGTAGGGAGAGCATCGGG - Intronic
1089183986 11:116602558-116602580 CTGGGTCCCAGGAGAACAGCGGG - Intergenic
1089322527 11:117636078-117636100 CTGGCTTCAAGGAGCACAGCAGG - Intronic
1089410276 11:118235462-118235484 CTGGGCTGAAGAAGAGGAGCAGG - Exonic
1092423736 12:8356343-8356365 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
1094275030 12:28664728-28664750 CAGAGTTTAAGGAGGACAGCAGG + Intergenic
1096548320 12:52356357-52356379 CAGGGGTGAAGGAGGGCAGCCGG + Intergenic
1096573892 12:52540736-52540758 CTGGGGCTGAGGAGAGCAGCAGG - Intergenic
1096798269 12:54092047-54092069 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1096838120 12:54364153-54364175 CTGGGTTTACTGAGAGCAGCGGG - Exonic
1097204686 12:57310553-57310575 CTGGGTTAAAGGAAGGCTGCTGG - Intronic
1098377442 12:69832341-69832363 CTGGCTCTTAGGAGAGCAGCAGG - Intronic
1099131315 12:78835692-78835714 ATGGGAGGAAGGAGAGCAGCAGG + Intergenic
1100089801 12:90955122-90955144 CTGGGTTGAGAGGGAGCAGCAGG - Exonic
1102358091 12:112257369-112257391 CTGGGTTTCTCTAGAGCAGCAGG - Intronic
1103428264 12:120857822-120857844 GTGGGTGGAAGGAGAGCATCAGG + Intronic
1105264477 13:18803860-18803882 CTGTGGTTAAGCACAGCAGCAGG + Intergenic
1110285471 13:73744986-73745008 CTTGGTCTAAAGAGTGCAGCTGG - Intronic
1110535339 13:76645106-76645128 CTGGGTTGAATGATTGCAGCTGG + Intergenic
1112873488 13:104005012-104005034 GTGGGTTTGAGGAGATCCGCGGG - Intergenic
1113045593 13:106151545-106151567 CTGGGTATCAGGACTGCAGCTGG + Intergenic
1113764718 13:112874197-112874219 CTGGTTTGGGGGAGAGCAGCAGG + Intronic
1116577388 14:46591778-46591800 CTGGGTTCAAGGAGAGTAGCTGG - Intergenic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119474377 14:74918694-74918716 CTGGATGCAAGGAGAACAGCTGG + Intronic
1119674567 14:76544238-76544260 CTGGTTTTAAAGATAGGAGCAGG - Intergenic
1120016296 14:79477706-79477728 GTGGGTTCAAGGAAAACAGCAGG + Intronic
1121890858 14:97589089-97589111 CTGAGGTTAAGCAGGGCAGCAGG + Intergenic
1121991565 14:98562663-98562685 CTGGGAGTCAGGAGAGCATCTGG - Intergenic
1123670107 15:22647893-22647915 CTGGGGGGAAGGAGAGCATCAGG + Intergenic
1123817219 15:23992178-23992200 CTGGGTTTATGGTAAGCATCTGG + Intergenic
1124045955 15:26149806-26149828 CGGGGGTTAGGGAGAGCACCAGG - Intergenic
1125353203 15:38789249-38789271 CTGAGTGTAAGGCGAGCAGGTGG + Intergenic
1127067691 15:55257486-55257508 CTGAGTTTAATCAGAGCAGCAGG - Intronic
1127185459 15:56475284-56475306 CGAGGTTTAAGGAGATCAGCAGG + Intergenic
1127480413 15:59372330-59372352 CCGGGTTTACGGAAAGCGGCAGG + Intronic
1127853543 15:62935826-62935848 CTGGGTCTAAAGAGACCAGAGGG - Intergenic
1128619212 15:69134520-69134542 TTGGCTAAAAGGAGAGCAGCAGG - Intergenic
1129763823 15:78148514-78148536 CTGGGATTGAGGACAGGAGCGGG + Intronic
1130100794 15:80892436-80892458 CTGGGTTTTAAGAGAGAAGGTGG - Intronic
1131426035 15:92346269-92346291 CTGGATTTCAGGATAGCACCAGG + Intergenic
1131672818 15:94638393-94638415 CTGGGTAGGAGGTGAGCAGCAGG - Intergenic
1132376441 15:101331390-101331412 TTGGGTTCAAGGAGCACAGCTGG - Intronic
1133256324 16:4518575-4518597 CTGGGGTTCAGGAAGGCAGCAGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1133447496 16:5874646-5874668 CTGAGAATAAGGAGAGCAGCTGG + Intergenic
1133610845 16:7432020-7432042 CTGGGTGTAAGGAAAGCAAGTGG - Intronic
1133720901 16:8493432-8493454 CTGGGCTTAATCACAGCAGCAGG + Intergenic
1134234213 16:12452736-12452758 ATGGGTGTGAGGAGAGGAGCCGG + Intronic
1137501127 16:49012612-49012634 ATGTCTTTAAGGAGAGAAGCAGG - Intergenic
1140408292 16:74725416-74725438 GTGGGTTTAAGTATAGCCGCTGG - Intronic
1140892405 16:79296374-79296396 CAGGGTGTAGGGAGAGCATCAGG + Intergenic
1141786772 16:86206053-86206075 CTAGGGTTCAGGAGAACAGCTGG + Intergenic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1141871668 16:86790656-86790678 CTGGGTTTATCAAGAGCAGCAGG + Intergenic
1141931486 16:87207553-87207575 CTGGGTTTAAGGTGAGGGCCGGG - Intronic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142779454 17:2169661-2169683 CTGGGTTGAAGGACAGTAGGAGG + Intronic
1143283210 17:5770307-5770329 CTGGTTTTGAGGAGAAGAGCGGG + Intergenic
1143630008 17:8133598-8133620 CTGGGCTTAAGGAACGCAGGGGG + Intergenic
1143691336 17:8568769-8568791 CAGTGTTGAAGGTGAGCAGCTGG + Intronic
1145007624 17:19346438-19346460 CTGGGTTCCAGGGCAGCAGCCGG - Intronic
1148520754 17:48273039-48273061 CTGGATTGAAGGAGTGCAGTTGG - Intronic
1150250965 17:63704298-63704320 CTGGGCTTCGGGAGAGCAGAGGG - Intronic
1150494234 17:65594848-65594870 CTGAGTTTAAGGGAGGCAGCCGG + Intronic
1150501803 17:65658298-65658320 CTGGGATTCAGGGGGGCAGCTGG + Intronic
1152049293 17:77959407-77959429 CCGGGTTTGAGGGGAGCGGCGGG + Intergenic
1152663281 17:81552739-81552761 CTGGGCTCTCGGAGAGCAGCTGG + Intronic
1155151988 18:23130253-23130275 ATTGGATTAAGGAAAGCAGCAGG + Intergenic
1156247768 18:35318541-35318563 CTGGACTTAAGGAAAGCATCAGG + Intergenic
1157290514 18:46406426-46406448 CTGGGATTAAGAAGACCAGAAGG - Intronic
1157737944 18:50067355-50067377 TTGGGTTGAAGGAAGGCAGCAGG - Intronic
1158765081 18:60441155-60441177 GTGGGTTGAGGGAGAGCACCAGG - Intergenic
1160219000 18:76958799-76958821 GTGGGTGTAATGAAAGCAGCAGG - Intronic
1160405423 18:78642892-78642914 CTGTGTGCAAGGAGACCAGCTGG - Intergenic
1162286967 19:9746039-9746061 CTAGGTATAAGGTGAACAGCTGG - Intergenic
1163660016 19:18571406-18571428 ATGGATTTCAGGACAGCAGCAGG - Intergenic
1165749903 19:38253305-38253327 CTGGGATTCGGGAGAGGAGCTGG + Intronic
1166483041 19:43188871-43188893 ATCAGTTTAAGGAAAGCAGCTGG - Intronic
1166685536 19:44793951-44793973 CTGGGTTCTAGGAGAGGAGGGGG + Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1168409924 19:56133426-56133448 CGGGTTTTAAGGCCAGCAGCAGG - Intronic
930997696 2:57741134-57741156 CTGGTTTTAATGACACCAGCAGG + Intergenic
932074138 2:68647431-68647453 CTGGGTTAAAGGAGAGAGACAGG - Intronic
933166578 2:79083297-79083319 CTGGCTCTGAAGAGAGCAGCGGG - Intergenic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
936068532 2:109349958-109349980 CTGGGCTCCAGAAGAGCAGCAGG - Intronic
936392295 2:112086628-112086650 CAGGGTTTTAGGAAAGAAGCAGG - Intronic
936558971 2:113520042-113520064 CTGGGTCTAAGGACAGAAGGAGG + Intergenic
937012019 2:118571555-118571577 CTGGGTTTAACGTCAGCAGATGG - Intergenic
937176453 2:119940936-119940958 CTGGCTTTAAGGAAGGGAGCTGG - Intronic
939475989 2:142687077-142687099 CTGGATTTAACAATAGCAGCTGG + Intergenic
940629971 2:156225795-156225817 GTGGGATGAAGGAGAGCATCAGG + Intergenic
942607629 2:177709382-177709404 CTGGCTTTGAGGGGAGCTGCAGG + Intronic
942910709 2:181241063-181241085 CTGGGTTTGAGGAGCACAGCAGG - Intergenic
942933137 2:181520518-181520540 CTGGATTAAAGGAGAGGAGAAGG + Intronic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1171111402 20:22486000-22486022 CCGGGGTTAAGGAGAGCATAGGG - Intergenic
1171798138 20:29582294-29582316 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1171850100 20:30301867-30301889 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1173607718 20:44343487-44343509 CTGGGTATAATGGGAGCAGGTGG - Exonic
1174190513 20:48737282-48737304 GTGGGTTTAGGGAAAGCATCGGG + Intronic
1175326427 20:58131795-58131817 CTGCCCTTATGGAGAGCAGCTGG + Intergenic
1175629039 20:60517032-60517054 CTAGGTTTATGGAAATCAGCTGG + Intergenic
1175732461 20:61363123-61363145 CTGGGTTCCAGGACAGCTGCCGG + Intronic
1176087634 20:63305297-63305319 CTGGCTTCAAGGGGAGCAGCTGG + Intronic
1176127728 20:63483390-63483412 CTGGGTTACAGGAGGGCACCGGG + Intergenic
1177045886 21:16169471-16169493 CTGGTTTCAAGGAGAGGAGGAGG + Intergenic
1178362538 21:31961104-31961126 CAGGGCTTAGGGAGAGCAGGAGG - Intronic
1179450656 21:41466410-41466432 CTGCGTGGCAGGAGAGCAGCCGG - Intronic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180725564 22:17944371-17944393 CAGGGTTCCAGGAGAGCAGGGGG + Intronic
1183124697 22:35764957-35764979 CTAGGGCTAAGGAGAGCAACAGG + Intronic
1184518485 22:44978249-44978271 CTGGGTGTGAGGAGTGCTGCTGG - Intronic
950190699 3:10974354-10974376 CAGGGAATAAGGAGCGCAGCGGG - Intergenic
950206779 3:11086965-11086987 CTGGGTTTCAGGAAACCATCAGG - Intergenic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
950880198 3:16317064-16317086 CTGTGTTTCAGGACAGCAGCAGG - Exonic
956588698 3:70890459-70890481 CTGTGTTTATGGAGATCAGGTGG - Intergenic
957067726 3:75539422-75539444 CTGTGTTTAAGGTGAGAAGTGGG - Intergenic
957178635 3:76847290-76847312 ATGGGTTTAATGAGGCCAGCTGG + Intronic
959890658 3:111551698-111551720 GTGGGGTGAAGGAGAGCATCAGG - Intronic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961409093 3:126705107-126705129 CGGGATTTAAGGAGAGCTGAAGG - Intronic
965959110 3:174407624-174407646 CTGGGTTAAAGCACAGAAGCAGG + Intergenic
966946278 3:184779228-184779250 TTGGGTCTCAGGAGAGCAGCGGG - Intergenic
967421517 3:189278316-189278338 CTGGGTGGAGAGAGAGCAGCAGG + Intronic
967500297 3:190189805-190189827 CTGGCTTAAAAGAAAGCAGCTGG - Intergenic
967711224 3:192710717-192710739 CTGGGATTGTGGAGAGCAGTTGG - Intronic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
969801157 4:9566618-9566640 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
971584280 4:28385371-28385393 CATTGTTTAAGGAGACCAGCTGG - Intronic
972238736 4:37165224-37165246 CTGGGAGTAAGGACAGCAGATGG - Intergenic
973601332 4:52545612-52545634 CTGGGCTAAAGGGGAGCAGCAGG - Intergenic
974899004 4:67973586-67973608 GTGGGTGGAAGGAGAGCATCAGG - Intergenic
976471477 4:85434191-85434213 CTGGCTTTGAGGATAGCAGAAGG - Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978278275 4:106978279-106978301 CTGGCTCTGAAGAGAGCAGCAGG - Intronic
979282969 4:118888140-118888162 TTGGGTTTAAGAAGATCAGCAGG + Intronic
982440716 4:155432778-155432800 CTGGGCTTTGGGAGAGCAGGAGG - Intergenic
984573484 4:181421182-181421204 CTGGGGTTAGGGACAGCACCAGG - Intergenic
985181948 4:187274081-187274103 CTAGCTTTAAGGAGAGGAGAGGG + Intergenic
986293349 5:6417789-6417811 TTGGCATTAAGGTGAGCAGCGGG + Intergenic
986293359 5:6417857-6417879 TTGGCATTAAGGTGAGCAGCGGG + Intergenic
986949589 5:13066803-13066825 CTAGATTTAAACAGAGCAGCTGG + Intergenic
987559111 5:19495623-19495645 CTGGGTTCAAGCCGAGTAGCTGG - Intronic
988487250 5:31677241-31677263 CTGGGTTTCAGGGGAGCTTCTGG + Intronic
988695735 5:33621055-33621077 CTGGGTCCAAGGAGACCACCTGG + Intronic
989170840 5:38469336-38469358 CTGGCTTGTAGGTGAGCAGCTGG - Intergenic
991964998 5:72081966-72081988 CAGGTTATAAGGAGGGCAGCTGG + Intergenic
995534410 5:113120805-113120827 CTGGGCTGAAGAAAAGCAGCTGG - Intronic
995857950 5:116613670-116613692 CTGGGTATCAGGAGAGCTGAGGG - Intergenic
997044717 5:130300413-130300435 AGTGGTTTATGGAGAGCAGCGGG + Intergenic
997275391 5:132582934-132582956 CTGGATTTAAGGAATGAAGCAGG + Intronic
997283204 5:132661356-132661378 CAGGGTTCAAGGAGGGCATCAGG + Intergenic
997724984 5:136112988-136113010 CTGGGGTTATGGAGAGTACCAGG + Intergenic
1000160151 5:158589558-158589580 CTGGGCATAAGCAGAACAGCGGG + Intergenic
1001589403 5:172855215-172855237 CTGGTTTCCAGGAGAGCAGTGGG + Intronic
1001639675 5:173235697-173235719 CTGGCTTTGGGGATAGCAGCAGG + Intergenic
1003199325 6:3944401-3944423 TGGGGTATAAGGAAAGCAGCAGG + Intergenic
1003813179 6:9807699-9807721 CTAGGTTGATGGGGAGCAGCAGG + Intronic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005367529 6:25094230-25094252 CTGGGTTTAAGGATAAAAACTGG - Intergenic
1005430989 6:25756612-25756634 CTGGCGTTAATGAGAGCAGTGGG - Intronic
1005615266 6:27566613-27566635 CTGGGTCCAAGGACAGTAGCTGG + Intergenic
1006106790 6:31721616-31721638 CTGGGTCTCAGGTGAGCACCTGG - Exonic
1007073054 6:39050138-39050160 CTGGGGCTCAGGACAGCAGCTGG - Intronic
1007102484 6:39259191-39259213 CTGGGTTGAGGGAGCTCAGCGGG + Intergenic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1009890925 6:69680876-69680898 CTGTGATTCAGGTGAGCAGCTGG - Intronic
1010259051 6:73794522-73794544 TTGGGTTTAAGTAGATGAGCTGG + Intronic
1010870669 6:81034237-81034259 ATGGCATTAAAGAGAGCAGCTGG - Intergenic
1012372012 6:98518887-98518909 CTGAGTTTATGGAGAGCATTAGG - Intergenic
1012557038 6:100526365-100526387 GTGGGTATAAGGAGAGGAGCAGG + Intronic
1013658368 6:112269077-112269099 CTGGGTTTAATGATTTCAGCAGG - Intergenic
1015500820 6:133931288-133931310 CCAGCTCTAAGGAGAGCAGCGGG + Intergenic
1015693823 6:135957229-135957251 ATGAGCTTAAGGAGAGGAGCAGG + Intronic
1015752809 6:136577629-136577651 TTAGGTTTAGGGAGAACAGCAGG - Intronic
1016363461 6:143291740-143291762 CTGTGTTCAAGGAAAGCAGAAGG + Intronic
1020286143 7:6682660-6682682 CTGGGGTCGGGGAGAGCAGCTGG - Intergenic
1020364945 7:7371190-7371212 CTGGTTTTAAGGAGAGCAAATGG + Intronic
1020639953 7:10742522-10742544 CTGGCTCTGAAGAGAGCAGCAGG + Intergenic
1022054853 7:26719750-26719772 CTAGGTTTTAAGAGATCAGCTGG - Intronic
1022709273 7:32835844-32835866 CTGGGTTTTAAGAGATCAGGTGG - Intergenic
1023745494 7:43319085-43319107 CTGGTTTTAAAGAGAACATCGGG + Intronic
1028306762 7:89275470-89275492 CTGGATTCAAAGAAAGCAGCAGG - Intronic
1029179199 7:98687788-98687810 CTGGGCTTAGAGAGAGGAGCAGG - Intergenic
1030180064 7:106697466-106697488 CAGGGTTTAAGGAGAAGAGAGGG - Intergenic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1032883404 7:136114368-136114390 CTGGCTCTGAAGAGAGCAGCGGG - Intergenic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1034077767 7:148249269-148249291 CTGCCTTTAAGTGGAGCAGCAGG - Intronic
1036175898 8:6538366-6538388 CGGGATGAAAGGAGAGCAGCTGG - Intronic
1036246982 8:7126291-7126313 CTGTGTTTAAGGTGAGAAGGGGG + Intergenic
1036253816 8:7188078-7188100 CTGTGTTTAAGGTGAGAAGTTGG - Intergenic
1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG + Intergenic
1039563364 8:38530670-38530692 ATGGTTTTCTGGAGAGCAGCAGG + Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1041536808 8:58936002-58936024 CTGGGGTTATGGAAAGCCGCTGG - Intronic
1042648797 8:71016488-71016510 CTGGGTTTAAGCAGAACATCTGG + Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1045238997 8:100381719-100381741 CTGGGTTGGAGGAGAGCTACAGG + Intronic
1046540534 8:115575644-115575666 GTGGGTTTCAGGAGAGGAGGTGG - Intronic
1047680948 8:127253505-127253527 CGGGGGTGGAGGAGAGCAGCAGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048200218 8:132367156-132367178 CAGGGTTGAAGGAGAGGAGAAGG - Intronic
1048340092 8:133532067-133532089 CTGGCTTAAAGGAAAACAGCTGG - Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049413878 8:142486378-142486400 CTGGGTTTAAGGTTGGCTGCAGG - Intronic
1049893880 9:96139-96161 CTGGGTCTAAGGACAGAAGGAGG - Intergenic
1052076375 9:24145690-24145712 CTGAATTTCAGAAGAGCAGCAGG - Intergenic
1052096533 9:24391026-24391048 CTGGCTCTAAAGAGAGCAGCGGG - Intergenic
1052366758 9:27620583-27620605 CTGGGTGAATGGAGAGCTGCAGG - Intergenic
1053735108 9:41096223-41096245 CTGGGTCTAAGGACAGAAGGAGG - Intergenic
1053787875 9:41665160-41665182 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1054157254 9:61649607-61649629 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054176151 9:61876502-61876524 CTGGGTTTAAGGTGAGAGGTTGG - Intergenic
1054661388 9:67704306-67704328 CTGGGTTTAAGGTGAGAGGTTGG + Intergenic
1054693274 9:68335174-68335196 CTGGGTCTAAGGACAGAAGGAGG + Intronic
1056031697 9:82560233-82560255 CTCAGTTTAAGGAGGGCTGCTGG - Intergenic
1056133231 9:83605832-83605854 CGGGGTTTCTGGAAAGCAGCTGG - Intergenic
1056537421 9:87542009-87542031 CTGAATTTAATGACAGCAGCAGG + Intronic
1057534243 9:95883354-95883376 CTGGCTGTATGGTGAGCAGCAGG + Intronic
1059427001 9:114227526-114227548 CTGGGGTTACTGTGAGCAGCTGG + Intronic
1059742355 9:117164530-117164552 AGGGGTTTAAGGAGACCAGGAGG - Intronic
1059954645 9:119502777-119502799 CTGGCTTTGAAGAGAGCAGCAGG + Intronic
1060926238 9:127457268-127457290 CTGGGCTGAGGAAGAGCAGCAGG - Intronic
1061767800 9:132892976-132892998 CTGGGTAAAAGCAGGGCAGCAGG - Exonic
1061818262 9:133208701-133208723 CTGCCTTTAAGGGCAGCAGCCGG - Intronic
1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG + Intergenic
1062463034 9:136669789-136669811 CGGGGTTCAAGAAAAGCAGCAGG - Intronic
1185894497 X:3845371-3845393 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1185899615 X:3883795-3883817 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1185904731 X:3922224-3922246 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1185994893 X:4935773-4935795 CAGGGTTTAAGGGGAACAGAGGG + Intergenic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1186920002 X:14268441-14268463 CTGGGTTTTTGGGGAGCAGGTGG - Intergenic
1188144749 X:26597195-26597217 CTGGGTCTTAGGAGGGCAGGGGG + Intergenic
1193775975 X:85642075-85642097 CTGGGGAAAAGGAGAGCATCAGG - Intergenic
1194021309 X:88695116-88695138 CTGGCTCTGAAGAGAGCAGCAGG + Intergenic
1195862889 X:109400128-109400150 CTGGATTGAAGGAGAGAGGCTGG + Intronic
1195917893 X:109953764-109953786 CTGGGTTGAAAGAGAGCAGGTGG - Intergenic
1196437790 X:115690854-115690876 CAGTGTTCAAGGAGCGCAGCAGG + Intergenic
1198218839 X:134581348-134581370 CTGAGTTTGAAGAAAGCAGCAGG + Intronic
1198677357 X:139145085-139145107 CTGGGTTAATGGAGGACAGCTGG + Intronic