ID: 1186448130

View in Genome Browser
Species Human (GRCh38)
Location X:9649580-9649602
Sequence AGATGTATAATGCAAATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186448128_1186448130 17 Left 1186448128 X:9649540-9649562 CCAGAGCTGAAGCAGAAGTTTTT 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG 0: 1
1: 0
2: 2
3: 12
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186448130 Original CRISPR AGATGTATAATGCAAATTAG AGG Intronic
902298346 1:15483625-15483647 ATATGTAAAATGCAAATAATTGG + Intronic
905382984 1:37577247-37577269 AGATGTATTATGCAAAGAAAAGG - Intronic
906397663 1:45481063-45481085 AGATATATAAAGTAAATAAGCGG + Intronic
907613356 1:55895711-55895733 AGGTGTATAAAGCAAAAAAGGGG - Intergenic
909031907 1:70551543-70551565 AAATGTATACTGCAAATTCAAGG + Intergenic
909696899 1:78477706-78477728 AGATGCATATTCCAGATTAGTGG + Intronic
910341822 1:86197150-86197172 AGATGACTATTGCAAATTAATGG - Intergenic
910413727 1:86974388-86974410 AGATGTGTAAGGCAAGGTAGAGG - Intronic
910920458 1:92340764-92340786 AGATTTGTAATGCAATTCAGTGG - Intronic
911060709 1:93745458-93745480 AAATGTTTTATGCAAATTAAAGG + Intronic
911262167 1:95699853-95699875 AGATGTTTAATGAAAATCACTGG + Intergenic
912252773 1:108028319-108028341 AAATGTAGAATGCAATTTTGTGG + Intergenic
912673975 1:111659792-111659814 AAATGTATACTGCAAATTCAAGG - Intronic
913671870 1:121104791-121104813 AGATGCATAAGGCAAAGTATGGG + Intergenic
914023645 1:143892236-143892258 AGATGCATAAGGCAAAGTATGGG + Intergenic
916088488 1:161288837-161288859 AGATGCATAAAGCAAAGTATGGG + Intergenic
917206611 1:172580532-172580554 ACATATAAAATGCAAATTAAGGG - Intronic
917241322 1:172951542-172951564 AGATGCATAAAGCAAAGTATGGG - Intergenic
917901813 1:179550260-179550282 AATTGTATAATGCAAATTAATGG + Intronic
918874412 1:190020958-190020980 AGATGTATAATGAGAATTCTTGG + Intergenic
919367344 1:196679576-196679598 AAATGTTTATTGCAAATTAAAGG - Intronic
919523509 1:198619013-198619035 AAACGTTTAATGCAAATTTGTGG + Intergenic
920700067 1:208211223-208211245 AGATCTATAATGCACAATAGTGG - Intronic
922003987 1:221510221-221510243 AGAGCTCTAAAGCAAATTAGAGG - Intergenic
923370636 1:233308558-233308580 AGATGTATAAAGATATTTAGTGG + Intergenic
923640924 1:235759652-235759674 TGATTTATAATGCAAAAGAGAGG - Intronic
924203925 1:241691102-241691124 AAATGTATATTGCAAATGATAGG + Intronic
1063189450 10:3679636-3679658 AGGTGGATAATGCACATTTGGGG - Intergenic
1063471166 10:6286923-6286945 AAATGTATATTGCAAATTCTAGG - Intergenic
1063814101 10:9752702-9752724 AGATGTATAATGCCAAATATTGG + Intergenic
1065393606 10:25210513-25210535 AGCTGTATAATGCCAAGTATTGG - Intronic
1065614624 10:27507221-27507243 ATATGTTTAATCCGAATTAGTGG + Intronic
1066023473 10:31326882-31326904 AAAAGTATAATCCAAATGAGAGG - Intronic
1067245407 10:44537327-44537349 AGATTTTTAATTCAATTTAGAGG + Intergenic
1067513439 10:46914708-46914730 AAATGTATGATACAAAGTAGTGG + Intronic
1067648813 10:48137134-48137156 AAATGTATGATACAAAGTAGTGG - Intergenic
1068645940 10:59468102-59468124 AAATGTATATTGCAAATTTAAGG + Intergenic
1068801364 10:61144427-61144449 AAATTTAAAATACAAATTAGGGG - Intergenic
1070656449 10:78274925-78274947 AAATGTATAATGCAAAATTAAGG + Intergenic
1074586551 10:114773046-114773068 AGATGAATAATGCAAAATAGAGG + Intergenic
1075154729 10:119965619-119965641 AAATGGATTTTGCAAATTAGTGG + Intergenic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1077832351 11:5887537-5887559 ACATGTATAATGCAACTTTCTGG + Intronic
1079490105 11:20979172-20979194 AGATTTATAAAGCAAATAAATGG - Intronic
1081008406 11:37776605-37776627 AGAAGAATAAAGCAAATTGGTGG - Intergenic
1081267579 11:41045324-41045346 AGATGTAAAAAGGAAATAAGAGG - Intronic
1081329325 11:41784938-41784960 AGATGTATAGGGCAAAGTATGGG - Intergenic
1081340291 11:41918960-41918982 AAATGTATATTGCAAATTCCAGG - Intergenic
1083133432 11:60648430-60648452 AAATGAATAATGAATATTAGAGG + Intergenic
1083518219 11:63280828-63280850 ACATGTATAATGAAAGTAAGGGG - Intronic
1085601146 11:77857209-77857231 AGAGGTATAATGGTAATGAGAGG + Intronic
1086140108 11:83488826-83488848 ATTTGTATAATACAAAGTAGTGG - Intronic
1086966617 11:93034598-93034620 AGGCTTATTATGCAAATTAGAGG - Intergenic
1087072251 11:94092635-94092657 ACATGTATAAGGCACATCAGAGG - Intronic
1087333242 11:96810802-96810824 AGATGCATAAGGCAAAGTATGGG - Intergenic
1088480327 11:110291038-110291060 AGATGAATAATGAAAATAACAGG + Intronic
1089092154 11:115886919-115886941 AGAGGTAGAATGAAAATTTGGGG + Intergenic
1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG + Intronic
1091884974 12:4010217-4010239 AGATTCAGAATGCACATTAGAGG - Intergenic
1093127036 12:15343045-15343067 AGATGGACAAGGCAAATGAGAGG - Intronic
1093592070 12:20914308-20914330 AAATGTATATTGCAAATTCTAGG - Intronic
1094443880 12:30508745-30508767 AGGTTTTTAAGGCAAATTAGTGG - Intergenic
1094724646 12:33101498-33101520 AGATGTATATTGCAATGCAGGGG + Intergenic
1095770389 12:45948398-45948420 AGAAGTGGAATGCAAATGAGTGG - Intronic
1096765735 12:53887525-53887547 AGCTGTAAAATGCAGATGAGAGG - Intergenic
1097670364 12:62529743-62529765 AGATGCAGAAAGCAGATTAGTGG - Intronic
1097934619 12:65231787-65231809 ATATTTATAATACTAATTAGAGG - Intronic
1098924996 12:76339607-76339629 AGACGTATAATACAAATTAGAGG + Intergenic
1099090630 12:78302846-78302868 AGATGGATAATTAAAAATAGAGG + Intergenic
1101649706 12:106665688-106665710 AAATATATATTGCAAATTATAGG - Intronic
1102667535 12:114588321-114588343 ACATGAATGATGCAAATTGGTGG + Intergenic
1103144122 12:118579355-118579377 AGAATTATAATGCAATTTATGGG + Intergenic
1104234630 12:126921587-126921609 AGAGGCAGAATGCAACTTAGTGG + Intergenic
1104517607 12:129442479-129442501 AGATGAAATATGCAAATTAAAGG + Intronic
1105390209 13:19969540-19969562 AGATGTATGATGAAATTCAGAGG + Intronic
1105957434 13:25297445-25297467 AAATCAATAATGCAAATTATAGG - Intergenic
1106828134 13:33546253-33546275 GGATGTATAATGAATATTTGTGG + Intergenic
1107775132 13:43831004-43831026 AGATAAATAATCTAAATTAGTGG + Intronic
1108013117 13:46042021-46042043 ATATGGATAATGTAATTTAGAGG - Intronic
1108962955 13:56259927-56259949 GTAAGTATAATGCAAATAAGTGG - Intergenic
1109218216 13:59614379-59614401 AGATGTTTAATACATATTTGTGG - Intergenic
1111659553 13:91192247-91192269 AGCTTTATAATGAAAAGTAGTGG - Intergenic
1114072085 14:19119995-19120017 AGAAGGATAATGTAAATGAGAGG - Intergenic
1114090171 14:19279969-19279991 AGAAGGATAATGTAAATGAGAGG + Intergenic
1114717844 14:24846265-24846287 TGCTGTAAAATGCAAATTATAGG - Intronic
1114990412 14:28279678-28279700 TAATATATAATGCAAACTAGAGG - Intergenic
1116280939 14:42906386-42906408 TGATCTATAATGCAAATAATAGG + Intergenic
1117369449 14:55063087-55063109 AGATGGATATGGCATATTAGGGG - Exonic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1118137744 14:63046663-63046685 TTGTTTATAATGCAAATTAGTGG + Intronic
1118698631 14:68410763-68410785 AGATGTAAGATGCAATTTGGAGG + Intronic
1120532252 14:85646288-85646310 AGATGTATGATCTGAATTAGTGG + Exonic
1120544012 14:85787398-85787420 ATTTGTATATTGCAAGTTAGAGG + Intergenic
1120987837 14:90349682-90349704 AGCTTTATAATGAATATTAGTGG + Intergenic
1121365319 14:93303797-93303819 AGATGGAAAATGGGAATTAGAGG + Intronic
1121998842 14:98629281-98629303 AGGTGGATGATGCAAATCAGTGG + Intergenic
1122083654 14:99284646-99284668 AAATTTATAAGGTAAATTAGGGG + Intergenic
1124189290 15:27559034-27559056 AGATGTATATTGTAAATCTGAGG - Intergenic
1126526374 15:49659576-49659598 AGGTGTATAATACTAATTTGGGG + Intergenic
1127420490 15:58800499-58800521 AGATTTATATTGTAAAGTAGTGG - Intronic
1127663640 15:61123436-61123458 AGGTGTCTAATCCATATTAGGGG + Intronic
1129855954 15:78825300-78825322 ATATGTATAATGCAAATCTTGGG - Intronic
1133893195 16:9901182-9901204 AGATGCTCAATGCAAATTTGTGG + Intronic
1135502589 16:23010082-23010104 AAATGTAAAAAGCAAAGTAGAGG + Intergenic
1138634705 16:58328408-58328430 AGATGCAGAAAGCAGATTAGTGG - Intronic
1138809330 16:60130065-60130087 AGATGCATAAGGCAAGGTAGAGG - Intergenic
1139271101 16:65683142-65683164 TGATGGAGATTGCAAATTAGAGG - Intergenic
1139359113 16:66386325-66386347 ACATGTATATTGCATATTCGTGG + Intronic
1139926709 16:70492199-70492221 AGATGAATAGGGCAAATTATGGG - Intronic
1142931727 17:3290966-3290988 AGATATATAATACATATTAATGG + Intergenic
1142998147 17:3773525-3773547 AGATGCATAAGGCAAAGTGGGGG + Intronic
1144070506 17:11667243-11667265 ATATATATAAAGCAAATTATAGG + Intronic
1145112312 17:20174674-20174696 AGATGTATAAAGGAAATGAAGGG - Intronic
1146853061 17:36239911-36239933 AGATGTATAGAAGAAATTAGGGG + Intronic
1146868971 17:36363791-36363813 AGATGTATAGAAGAAATTAGGGG + Intronic
1147071846 17:37964426-37964448 AGATGTATAGAAGAAATTAGGGG + Intergenic
1147083373 17:38043952-38043974 AGATGTATAGAAGAAATTAGGGG + Intronic
1147099317 17:38167923-38167945 AGATGTATAGAAGAAATTAGGGG + Intergenic
1148133944 17:45279849-45279871 AGATGTCCAATGAATATTAGAGG + Intronic
1149113762 17:53066021-53066043 AGAAGTATAATGCAAATACCTGG + Intergenic
1149235049 17:54579358-54579380 AGATAGATAATTCAAAATAGTGG + Intergenic
1149836985 17:59922002-59922024 AGATGTATAGATGAAATTAGGGG - Intronic
1150082330 17:62251220-62251242 AGATGTATAGAAGAAATTAGGGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153230986 18:2935836-2935858 AAATGTATAATAAAAAGTAGAGG + Intronic
1154314127 18:13290498-13290520 AAATGAAGAAAGCAAATTAGTGG - Intronic
1155015088 18:21828497-21828519 AAATGTATAATTAATATTAGAGG - Intronic
1155474244 18:26222151-26222173 AAAGTTATAATGCAAAGTAGGGG - Intergenic
1156381455 18:36565203-36565225 TGGTGAATAATGGAAATTAGGGG + Intronic
1156959661 18:43009840-43009862 GAATGCATCATGCAAATTAGAGG - Intronic
1158701945 18:59756089-59756111 AGATGAAAAATAAAAATTAGTGG - Intergenic
1158838916 18:61362285-61362307 ATATGTATAATGCAGAAAAGGGG - Intronic
1164782932 19:30908035-30908057 AGATGTCTAATTCACATAAGTGG - Intergenic
1167813725 19:51859025-51859047 AGAGAAATAAAGCAAATTAGTGG - Intronic
929076178 2:38080746-38080768 AGATGTAAAATGGAAAGTTGAGG + Intronic
929289648 2:40175324-40175346 AGATGAATAATGAAAGTAAGAGG + Intronic
929295566 2:40242618-40242640 AGATGCCTAATGCAAAGAAGTGG - Intronic
933206960 2:79517708-79517730 AGGTATATAATGCAAATTTATGG - Intronic
934124553 2:88874571-88874593 TGATTTAAAATGCAAATAAGGGG - Intergenic
934796201 2:97101977-97101999 AGATGTATATTGCAAATCTAAGG + Intergenic
935198013 2:100831857-100831879 AGATGTAAAATGCAGGATAGGGG - Intronic
935512413 2:103992405-103992427 ATATGTATTATGCAAATAAGAGG - Intergenic
935647080 2:105346828-105346850 AATTGTATAATGGAAATCAGTGG + Exonic
937029673 2:118727969-118727991 AGGTGTTAAATGCAAATTGGAGG + Intergenic
937329263 2:121015533-121015555 AGAGATAGAAAGCAAATTAGTGG + Intergenic
937510579 2:122590497-122590519 AGACTTATAAGGCAAATCAGTGG + Intergenic
938737403 2:134198771-134198793 AGATGAAGAATGCAAAGCAGTGG - Intronic
939883970 2:147661032-147661054 AGATGTATAAGGCAAAGTGTGGG + Intergenic
940971087 2:159897585-159897607 AGATGGATAATGGAAAGTATGGG + Intronic
941066469 2:160908532-160908554 AGAAGAATAATGCAAATAAAAGG - Intergenic
942354924 2:175100453-175100475 AGATGTAAAAAGTAAAGTAGAGG + Intronic
942743274 2:179203540-179203562 AGATGTTTAATGCAAGGTATCGG - Intronic
943510515 2:188820539-188820561 ACATGGGTAATTCAAATTAGGGG + Intergenic
943883654 2:193182388-193182410 AGATAAAAAATGCAAATGAGAGG + Intergenic
943981516 2:194558346-194558368 AGAAGTACAATGCAATCTAGTGG + Intergenic
944912893 2:204327603-204327625 AGAAGTACAAAGCAAATTTGGGG + Intergenic
945092734 2:206191063-206191085 AGATGTATAATGTAAATATCAGG + Intronic
945448740 2:209969334-209969356 AGCTATATAAATCAAATTAGTGG + Intronic
947676089 2:231981731-231981753 AGATGTTTAATACTAATTGGTGG + Intronic
1169949158 20:11023745-11023767 AGATGTAGAAAGTAAATTAATGG - Intergenic
1170015026 20:11770731-11770753 AGATGTATAATCCTATTTACAGG + Intergenic
1170959240 20:21010427-21010449 AGATCTATAAGGCAAAGTATAGG + Intergenic
1173473406 20:43340875-43340897 AGAGGTAGAAAGTAAATTAGTGG + Intergenic
1174026630 20:47582123-47582145 AAATGGATAATGCAAAGTGGAGG - Intronic
1174683708 20:52433197-52433219 AGCTGTATAAGGCAAATTCAAGG + Intergenic
1178093351 21:29187897-29187919 AGACTTATAAGGCAAATTAAAGG + Intergenic
1178385571 21:32146491-32146513 AGATGTAAAATATGAATTAGTGG + Intergenic
1178939796 21:36895727-36895749 AGATGTATAATTCAATGTATGGG - Intronic
1180490527 22:15842350-15842372 AGAAGGATAATGTAAATGAGAGG - Intergenic
1182413790 22:30208151-30208173 AGGTCTATGATGGAAATTAGGGG + Intergenic
949107170 3:213600-213622 TCAAGTATAATGCAAAATAGAGG + Intronic
949304995 3:2629666-2629688 AGATGTATCAGGAATATTAGTGG - Intronic
949455580 3:4234947-4234969 ATATGTATAATACATATCAGAGG + Intronic
949726876 3:7059148-7059170 ATATGTAAAATGTAAAGTAGGGG - Intronic
952300645 3:32101774-32101796 AGATGTTTAATGAAAATCATGGG - Intergenic
953156816 3:40383035-40383057 GGATGTATGATCCAGATTAGGGG + Intergenic
953698819 3:45180492-45180514 AGATGTATCAGACAAATTAAGGG + Intergenic
956238258 3:67099481-67099503 AAATGTATATTGTAAATTTGGGG + Intergenic
959735598 3:109654444-109654466 AGATGTATACTGTAATTTATAGG - Intergenic
960173512 3:114490765-114490787 ATATGTATGATGCATACTAGAGG + Intronic
960334951 3:116405702-116405724 AGATCTATAAGGCTCATTAGAGG + Intronic
962994603 3:140613187-140613209 AGATGTTAAAAGCAATTTAGAGG + Intergenic
963627115 3:147687546-147687568 AGAATTATAATGCAATTTAGTGG + Intergenic
967376322 3:188806714-188806736 AGGTGTATATTGCAAATCAAAGG - Intronic
969136375 4:5032528-5032550 AGATGGAAAATGCAGTTTAGGGG - Intergenic
970100986 4:12522393-12522415 TGATGTGAAATGCAAATGAGAGG - Intergenic
970421365 4:15908412-15908434 AGATGCATCAGGCGAATTAGTGG + Intergenic
970434423 4:16019663-16019685 AGATGTGAAATTTAAATTAGAGG + Intronic
971049347 4:22843305-22843327 AGATGGACAACGCAATTTAGTGG + Intergenic
971701971 4:29989535-29989557 AGATGTTTAATGCAAAACATAGG + Intergenic
972380660 4:38516872-38516894 AGTTGTGGAATGCAAATAAGGGG + Intergenic
972581833 4:40401905-40401927 AAATGACTAATGGAAATTAGGGG + Intergenic
972624738 4:40785766-40785788 ACATGTAGAATGCAACTAAGAGG + Intronic
973839739 4:54849188-54849210 AGATAGAAAATGAAAATTAGAGG + Intergenic
974696193 4:65376182-65376204 AGATTTCTAATGCATGTTAGAGG - Intronic
974870337 4:67635724-67635746 ATATGTATATTGCAGAATAGGGG - Intronic
976214309 4:82701193-82701215 AAATGTATATTGCAAATTCTAGG + Intronic
976224162 4:82782002-82782024 AGATGTTAAATGCAACTGAGAGG - Intronic
976347312 4:84019297-84019319 AGATGTTTAATTCACATTGGAGG - Intergenic
978259224 4:106733126-106733148 AGAATTATAATGTGAATTAGTGG - Intergenic
978779876 4:112540565-112540587 AAATGCAAAAAGCAAATTAGAGG - Intronic
978972438 4:114826001-114826023 AGATTTATAATATAAATTGGAGG + Intergenic
981134294 4:141192449-141192471 AAATATATAATGCTAATTTGTGG + Intronic
981365740 4:143900791-143900813 AGAGGTAGAAAACAAATTAGTGG + Intronic
981375839 4:144014589-144014611 AGAGGTAGAAAACAAATTAGTGG + Intronic
981386363 4:144135970-144135992 AGATGTAGAAAACAAATTAGTGG + Intronic
981540942 4:145845750-145845772 AGATGTTTAGTACATATTAGTGG + Intronic
981754355 4:148125003-148125025 AGATGTTTTATTCAAATTTGGGG + Intronic
982133843 4:152255206-152255228 AAATGTATATTGCAAATTCTAGG - Intergenic
982315456 4:154026283-154026305 AGATGTTTAATGCAAATGATAGG - Intergenic
983689219 4:170447706-170447728 AGAGACAGAATGCAAATTAGTGG - Intergenic
984429021 4:179624921-179624943 AGATGTACAAGACAAATCAGTGG - Intergenic
985352813 4:189084242-189084264 AGATGTAAGATGAAAATTTGGGG + Intergenic
986642414 5:9885389-9885411 AGCTGTATAAGGCAAATGAAAGG - Intergenic
986979455 5:13429976-13429998 GGATGTATAAGACAGATTAGAGG + Intergenic
989353976 5:40520190-40520212 AGATGTAAAGTTCAAATTAATGG - Intergenic
989554414 5:42775882-42775904 AAATGTATATTGCAAATTCTAGG + Intronic
989815468 5:45731701-45731723 AAATGTATATTGCAAACTTGAGG + Intergenic
989822243 5:45807765-45807787 ATATGTATATTGCAAATTCCAGG + Intergenic
990666980 5:58083517-58083539 TAGTGTATAATGCAAATTGGAGG - Intergenic
991324868 5:65419796-65419818 AGAGAAATAATGTAAATTAGTGG + Intronic
991898073 5:71426759-71426781 AGATGTATCAGGCAAATTCTTGG + Intergenic
992596135 5:78349052-78349074 AGAATTATTATGCAAAATAGAGG - Intergenic
993916531 5:93750165-93750187 TCAAGAATAATGCAAATTAGGGG + Intronic
994032096 5:95155234-95155256 AGATGTTGAATGAAAATTACAGG + Intronic
994505132 5:100633259-100633281 AGATGTATTTTGAAAATTTGAGG + Intergenic
995052094 5:107718797-107718819 AAATGTATAGTGCAAATTCTAGG + Intergenic
996076920 5:119206769-119206791 AGATGTAACATGCAAAATACTGG - Intronic
996233527 5:121097233-121097255 AAATGTATATTGCAAATTCTAGG + Intergenic
996471178 5:123862638-123862660 AGATTTATTATCCAAATTAAAGG - Intergenic
998035948 5:138916151-138916173 AGAGATAGAAAGCAAATTAGTGG + Intronic
999096742 5:148985484-148985506 AAATGCATTATGCTAATTAGAGG - Intronic
999580553 5:153033756-153033778 AGATGTAAAAAGTAAAGTAGAGG - Intergenic
1000754213 5:165136290-165136312 AGATGTGTAATTGAGATTAGGGG - Intergenic
1000851985 5:166351357-166351379 AGATTTATAATCCAATTTAGCGG - Intergenic
1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG + Intronic
1001985355 5:176069927-176069949 AGATGCATAGTGCAAAGTATGGG - Intronic
1002027324 5:176404425-176404447 ATTTGTAAAATGCGAATTAGAGG - Intronic
1002231515 5:177768192-177768214 AGATGCATAGTGCAAAGTATGGG + Intronic
1002263826 5:178015556-178015578 AGATGCATAGTGCAAAGTATGGG - Intronic
1003436538 6:6094014-6094036 ATATGTGCAATACAAATTAGGGG + Intergenic
1003488276 6:6598186-6598208 AGATGTTTAAGACAAATTTGTGG - Intronic
1004242225 6:13934781-13934803 AGATAATTAATGCAAATGAGTGG + Intronic
1004464233 6:15869142-15869164 AAATGTAAAATGCCAATTAAAGG - Intergenic
1004856323 6:19754356-19754378 GGAAAAATAATGCAAATTAGTGG + Intergenic
1005143764 6:22664143-22664165 AGATTTAAAATGCCAACTAGAGG + Intergenic
1005318281 6:24626151-24626173 AGAGATAGAATGCAAATCAGTGG + Intronic
1006341743 6:33451205-33451227 AGGTGTACTAAGCAAATTAGTGG - Intronic
1008360475 6:50611662-50611684 AAATGTAAAAAGCAAATTACAGG + Intergenic
1008768445 6:54949017-54949039 AGATGTAAAATGAAAATAATTGG - Intergenic
1009514995 6:64604019-64604041 AGAGAAATAATGCAGATTAGGGG - Intronic
1009549733 6:65073562-65073584 AGATATATAATAAAAATTAGAGG + Intronic
1011886921 6:92108300-92108322 AGATGAAATATGCAAATTATTGG - Intergenic
1012296298 6:97529187-97529209 AGATACATAATTCAACTTAGAGG - Intergenic
1012433867 6:99193910-99193932 AGATGTGAAGTGCACATTAGAGG - Intergenic
1012485942 6:99722665-99722687 AGATGTACAGTGCAAATTGTTGG - Intergenic
1012513735 6:100034235-100034257 ACATGTAGAATGAAAATTTGGGG + Intergenic
1012582890 6:100890090-100890112 AGATGGATAGGGCATATTAGGGG - Intergenic
1012643047 6:101646186-101646208 AGATGCTTAATGCACATTTGGGG + Intronic
1013633960 6:112010880-112010902 GGATGCATAAACCAAATTAGAGG + Intergenic
1014177308 6:118344896-118344918 ACATTTATACTGCAAATTACTGG + Intergenic
1014762632 6:125374513-125374535 AGAAGTAAACAGCAAATTAGTGG - Intergenic
1015953080 6:138573485-138573507 AGATGTATGATGCAAAATTCTGG - Intronic
1016088980 6:139952417-139952439 AAATATATAATGATAATTAGAGG - Intergenic
1016480284 6:144473430-144473452 TGATTTAAAATGCAAATTACAGG - Intronic
1017334226 6:153236412-153236434 AGATGAATAAAGCAGATGAGGGG - Intergenic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1020397611 7:7734748-7734770 AGGTGGTTAATGCAAATTAATGG - Intronic
1020695390 7:11407446-11407468 GGATGTATATTGTAAATTGGGGG + Intronic
1021338091 7:19428821-19428843 AGAGGTCTAATGAAAAGTAGTGG + Intergenic
1021904088 7:25316133-25316155 ATATTTATAATGCATATGAGTGG - Intergenic
1022633434 7:32107947-32107969 ATATGTATATTGCAAATTCTAGG + Intronic
1024843920 7:53620252-53620274 AGATGTAAAAAGTAAAGTAGAGG - Intergenic
1026426889 7:70303720-70303742 ACATGTATAATGCAGATTGAGGG - Intronic
1026681216 7:72467904-72467926 AGAGATATAATACAAATTGGTGG - Intergenic
1027536041 7:79403142-79403164 CAATGTATAATAAAAATTAGAGG + Intronic
1028481632 7:91312993-91313015 AGATTTATTTTGCAAATTATAGG - Intergenic
1029883274 7:103839056-103839078 ACATTTCTAATGCAAATTATTGG - Intronic
1030158194 7:106478605-106478627 AGAAATATAATGGAAATTAGGGG - Intergenic
1030814106 7:114013156-114013178 AAATTAATAATGAAAATTAGGGG + Intronic
1030937568 7:115603972-115603994 AGATGTAGAATACAGATTGGTGG - Intergenic
1032373533 7:131385068-131385090 AGAGGCATAAAGCAGATTAGTGG - Intronic
1032514073 7:132494146-132494168 AGAGGTATCATGAAAATTAAAGG + Intronic
1035123156 7:156585868-156585890 AAATGTATATTGCAAACTATGGG + Intergenic
1036027092 8:4921395-4921417 ACATGTATAATGTGAATTAATGG + Intronic
1037192933 8:16149160-16149182 AAATCTATAATGTACATTAGTGG - Intronic
1037395901 8:18442561-18442583 AAATGTATATTGCAAATTCTGGG - Intergenic
1037442290 8:18928609-18928631 AGAGATAAAAAGCAAATTAGTGG + Intronic
1038158265 8:25011776-25011798 AGATGTTTAATGCATATTTAAGG + Intergenic
1039362308 8:36890460-36890482 AAATATATATTGCAAATTTGAGG + Intronic
1039833934 8:41240567-41240589 AAATGTATATTGCAAATTCTAGG - Intergenic
1040623495 8:49116872-49116894 TGATGTAGAATGTAAATTGGTGG - Intergenic
1041061284 8:54037048-54037070 AGATGTAAATTCCAAAGTAGTGG - Intergenic
1041193271 8:55374784-55374806 AAATGAAGAATGCAAATTAGAGG + Intronic
1041212072 8:55562008-55562030 AAATGTATATTGCAAATTCTAGG - Intergenic
1041960500 8:63609836-63609858 AGATATATAATGCAAATGCTGGG - Intergenic
1043773092 8:84229376-84229398 ACATGTAGAATGCAAAATAAAGG + Intronic
1045382581 8:101642105-101642127 AGATGTAGAAAGCAAATTTCAGG - Intronic
1046730056 8:117715016-117715038 TGATGTATAATAGAAATTAAAGG - Intergenic
1047476914 8:125241326-125241348 AAATGTATAATGCAGTTGAGGGG + Intronic
1050406190 9:5310655-5310677 AAATGTATATTGCAAATTCTTGG - Intergenic
1052238201 9:26238751-26238773 AGATGTTTTATGCTAATGAGGGG - Intergenic
1052265550 9:26567821-26567843 AGAGGTAAAAAGCAGATTAGTGG - Intergenic
1052538188 9:29774954-29774976 AGATATATAAAGCAAATGACAGG + Intergenic
1055749430 9:79488472-79488494 AGCAGTAAAATGCTAATTAGCGG - Intergenic
1056224392 9:84481069-84481091 AAATGTAAAAAGCAAATTATTGG - Intergenic
1058293979 9:103281803-103281825 ATATGTATGAAGTAAATTAGTGG - Intergenic
1059668342 9:116470737-116470759 AGATGAATAAGGGAAATTATGGG + Intronic
1060691982 9:125670088-125670110 TGATTTATAATTGAAATTAGAGG + Intronic
1186375478 X:8994656-8994678 AGAAGCAGAATGCAAAATAGTGG + Intergenic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1187684385 X:21801765-21801787 AGAGATAGAAAGCAAATTAGAGG + Intergenic
1190488907 X:50961147-50961169 AGAGATATAAAGCATATTAGTGG + Intergenic
1191817574 X:65264556-65264578 AGATGTTTAATGAATATTATTGG - Intergenic
1193464470 X:81831249-81831271 TGATGAATAATAAAAATTAGTGG - Intergenic
1194236734 X:91393855-91393877 AAATGTATATTGCAAACTATAGG - Intergenic
1194671935 X:96744523-96744545 AGAAGTAGAAGGCAAATCAGAGG + Intronic
1195408082 X:104539051-104539073 AGTTTTATAAAGCAATTTAGTGG - Intergenic
1197457681 X:126698480-126698502 AAATGTATATTTCAAATGAGTGG - Intergenic
1197487383 X:127070229-127070251 AGATGTAGAATGAAAATAATGGG - Intergenic
1197643810 X:128995565-128995587 AAATGTATATTGCAAATTCAGGG + Intergenic
1198120460 X:133587581-133587603 ACATTTATAATGAAAATTATTGG + Intronic
1199017778 X:142838944-142838966 ATATGTATAATGCAAATGCAAGG - Intergenic
1199204021 X:145125847-145125869 AGCAGTATAATGCCAATTATTGG - Intergenic
1200313357 X:155103034-155103056 AGATGTATACTATAAACTAGTGG - Intronic