ID: 1186448748

View in Genome Browser
Species Human (GRCh38)
Location X:9654603-9654625
Sequence CTTGGCCTCCACCTCGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186448748 Original CRISPR CTTGGCCTCCACCTCGGCGA GGG Intronic
900289270 1:1917000-1917022 CTCCGCCTCCACCTCGTTGAGGG - Exonic
901829899 1:11885973-11885995 CTTGGTTTCCACCTCAACGAGGG + Intergenic
902371971 1:16013064-16013086 CTTGGCCGCCAGCCCGGCCAAGG - Intergenic
907497070 1:54852257-54852279 CTTGTCGTACACCTCGGGGAAGG + Exonic
912099163 1:106184711-106184733 CTAGGCCTCCAGGTCTGCGATGG - Intergenic
912859357 1:113199130-113199152 CTTGACCTCCACCTGGTTGAAGG - Intergenic
915626040 1:157114754-157114776 CCTGGCCTCCACCTGGAGGAAGG - Intergenic
923478156 1:234356818-234356840 CTTGACCTCCACCTGGTTGAAGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067567904 10:47351342-47351364 CTTGGCCCCCAGCTCGGCAGAGG - Exonic
1068461678 10:57337193-57337215 CTGGGCCTCCACCTCTGCTCTGG - Intergenic
1069823523 10:71241740-71241762 CTGGGCCTCCACTTGGGCAATGG - Intronic
1071381103 10:85061048-85061070 CTTGGCATGGACCTCGGGGAAGG + Intergenic
1073219075 10:101854573-101854595 CTTTGCCTCAACTTAGGCGAGGG + Intronic
1073285465 10:102384966-102384988 CTTGGTTTCCACCTCCGCAATGG + Intergenic
1074780810 10:116800632-116800654 CTTGCACTCCATCTCCGCGATGG + Intergenic
1076670301 10:132117351-132117373 CTTGGCCTCCTCCTTGGCCTCGG - Exonic
1084621401 11:70272217-70272239 CATGGCCTCCACCTCCTCCAGGG - Exonic
1088500822 11:110480611-110480633 CTTGGACTCTACCTCGACAAAGG - Intergenic
1092145803 12:6213848-6213870 CTTGGCCCCCACCAGGGCTAGGG + Intronic
1096178367 12:49537999-49538021 CTTGGCCTCCCGCGCTGCGACGG - Intergenic
1102654267 12:114467582-114467604 CTAGGACTCCACCTGGGTGACGG + Intergenic
1103527191 12:121576880-121576902 CTTGGCCTCCTCCTCCCCCAAGG - Intronic
1104731110 12:131105804-131105826 CTGGGCCACCAGCACGGCGAAGG - Exonic
1107978685 13:45714035-45714057 CTTGGCCTCCTCCTCCCCGGAGG - Exonic
1111993505 13:95139595-95139617 CTTGGCCTCTACCTCCAGGAAGG + Intronic
1113627246 13:111856408-111856430 CTTGGTCTCCACCTTGGTGGTGG + Intergenic
1116545082 14:46155317-46155339 CTTGCCCTTCACCTCTGCCATGG + Intergenic
1121625623 14:95383729-95383751 CTTGTCCTCCAACTCTGCTAAGG + Intergenic
1122243928 14:100387804-100387826 CTTGGACACCACCTGGGTGAAGG - Intronic
1124128915 15:26967879-26967901 GTTGGACTTCACCTCGGCGGGGG - Intergenic
1124957257 15:34367430-34367452 CCTGGCCTCCGCCTCGGAGTGGG + Intergenic
1127261052 15:57326487-57326509 CCTGGCCTCCACCTCGGTCCCGG + Intergenic
1131426985 15:92353977-92353999 CTAGGCCTCCAGGTCGGTGATGG - Intergenic
1133315801 16:4883282-4883304 CTTGGCCTGCACCAGGGCAAGGG + Exonic
1134624985 16:15717178-15717200 CTTGGCCTCCAGCGCCGCGATGG + Exonic
1142144057 16:88485331-88485353 CTTGGCCTCCACCACGCCCACGG - Intronic
1142807476 17:2379123-2379145 GTAGGCCTCCACCAGGGCGAGGG - Exonic
1144832437 17:18139341-18139363 CTTGGCCTCACCCTCAGTGAAGG - Intronic
1145789006 17:27613208-27613230 CTTGGCCTCCTTCTGGGCCAGGG + Intronic
1150013794 17:61532776-61532798 TTTGGCCTCCAGCTCGGCCCTGG + Intergenic
1150137597 17:62704167-62704189 CCCAGCCTCCGCCTCGGCGAGGG - Intronic
1152244336 17:79177318-79177340 CTTGGCCTCCACCTCCTCCAAGG + Intronic
1152444870 17:80336189-80336211 CCTGGCCTCCATCTCAGCGGGGG + Exonic
1153820178 18:8825628-8825650 CTTGGCCTGCACCTTCTCGATGG - Exonic
1154024607 18:10695740-10695762 CTTTACCTCCACCTCTGCTAAGG + Intronic
1154025738 18:10705674-10705696 CTCAGCCTCCACCTCCTCGATGG + Exonic
1160827339 19:1086730-1086752 CTGGGCCTCCCCCTAGGGGAGGG + Exonic
1161596018 19:5151366-5151388 CTTGGCCTCCTCCCCCGAGAAGG - Exonic
1161801022 19:6416813-6416835 CTTGGCCTCTTCCTCGGCCTCGG + Exonic
1162771767 19:12953527-12953549 CTTGGCCTCCAGCCTGGAGAAGG + Exonic
1162950702 19:14070708-14070730 CTGGGCCTCCAGCTTGGAGATGG - Intergenic
1164156917 19:22602700-22602722 CCTGGCCTCCGCCTCACCGATGG - Intergenic
1165389172 19:35528516-35528538 CTTGCCCTCCACCCCAGAGATGG + Intergenic
925086955 2:1115959-1115981 GTTGGCCCCCACCTCCGCCAAGG - Intronic
926670455 2:15572739-15572761 CCTGGGCTCCACCTCGGACAGGG + Intergenic
927717383 2:25361440-25361462 CTTGGCCTCCAACTCTGTGCTGG + Intergenic
928095904 2:28404860-28404882 CTAGGCCTCCAACTCGGAGCAGG + Intronic
929801225 2:45104770-45104792 CTTGGCCTCCACATTGAAGATGG - Intergenic
935622012 2:105138375-105138397 CTGGGCCTCCAGCTCGAAGATGG - Intergenic
937095651 2:119233768-119233790 CCTGGCCTCCACCTGGGCCTAGG - Intronic
938080997 2:128370105-128370127 CTTGGCCTCCTCCACAGGGACGG - Intergenic
947595586 2:231409690-231409712 CTGGGCCTCCACCTGGGCCTGGG - Intergenic
948816475 2:240512838-240512860 CTTGGCGTCCACATCGGTGATGG + Exonic
1168813212 20:719807-719829 CAGGGTCTCCACCTGGGCGACGG + Intergenic
1169212886 20:3777677-3777699 CCTGGGACCCACCTCGGCGACGG - Exonic
1171193822 20:23181089-23181111 CATGGCCTCCACCTTGCAGAGGG - Intergenic
1173576503 20:44115800-44115822 CTTGGGCTCCAGCTTGGCGGGGG + Exonic
1174312880 20:49672775-49672797 CTTGGCCTCGACCTCCGCAAAGG + Intronic
1175845172 20:62054459-62054481 CCTGGCCTCCAGCGCAGCGATGG - Intronic
1180540914 22:16446882-16446904 CTAGGCCTCCAACTCTGTGACGG + Intergenic
1183184107 22:36282097-36282119 CTGGGCCTCCACCTCTGTGCAGG - Exonic
1184091022 22:42293081-42293103 CTTGGCCTCCTCCTGGGCTTGGG - Intronic
1184642502 22:45879868-45879890 TGTGGCCTCCACCCCGGCCAGGG + Intergenic
1185344006 22:50303588-50303610 CTTGGTGTCCACCTCTGAGAAGG - Intronic
950125435 3:10507143-10507165 CTTGGCCTCCACTGGGGCAAGGG + Intronic
950140684 3:10613028-10613050 CCTGGCCTCCACCGAGGGGAGGG + Intronic
960239428 3:115323039-115323061 CTTGGTCTCCACCTCCCCGGTGG + Intergenic
960808671 3:121608128-121608150 CTTGGCCCCCACATCTGCAAGGG + Intronic
968481953 4:837176-837198 CTCGGCCTCCACCGCAGCCAAGG + Intergenic
968491652 4:893431-893453 CTGGTGCACCACCTCGGCGATGG + Exonic
969261480 4:6036923-6036945 GTTAGCCTCTACCTCGGTGATGG - Intronic
969695936 4:8734904-8734926 CCTGGCCTCCACCACTCCGATGG + Intergenic
972621231 4:40750033-40750055 CTTCGCCGCCACGTCCGCGAAGG + Exonic
987286788 5:16465477-16465499 CTTGCTCTCCTCCTCCGCGACGG + Exonic
998175743 5:139900977-139900999 CTAGGTCTCCACCTAGGAGAAGG + Intronic
1002426019 5:179176403-179176425 CTTGGCCTCCTCCGCTGGGATGG + Intronic
1005989298 6:30893209-30893231 CTGGGCCTCCCCCTCGGCTAGGG + Intronic
1006610714 6:35292722-35292744 CGTGGCCTCCAGCTCGCCGTGGG - Exonic
1006942550 6:37762622-37762644 CTCGGCCTCCTCCTCTGCCACGG + Intergenic
1018826207 6:167409532-167409554 CTTGCCATCCACCACAGCGAGGG - Intergenic
1019493390 7:1325319-1325341 CTTGGCCTCCAGAACGGTGACGG + Intergenic
1019513465 7:1429709-1429731 CTTGGCCTCCATCTGGGAGGAGG - Intronic
1019577887 7:1746266-1746288 CTTGTCCACCTCCTTGGCGATGG - Exonic
1021415961 7:20385149-20385171 CTTGGCCTCCACCAAGGGGTGGG - Intronic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1037534003 8:19808151-19808173 TCTGGCCTCCACCTCAGCTAAGG - Intergenic
1045007801 8:97931337-97931359 CTTAGCAGCCACCTCGGCCACGG - Exonic
1049306516 8:141907011-141907033 CCTGGCCTCCAGCTCAGCGTGGG + Intergenic
1049351600 8:142167549-142167571 CTTGGCCACCACCGGGGAGAAGG + Intergenic
1049963833 9:760971-760993 CTGGGCCTCCACCTCACAGATGG - Intergenic
1051183705 9:14437835-14437857 CTTGGCCTCCAGCCCAGTGATGG - Intergenic
1062408719 9:136410598-136410620 CTTCCCCTCCCCCTCGCCGACGG - Exonic
1062514494 9:136925816-136925838 CTTTGCCTCCATCTTGGAGACGG - Exonic
1062653368 9:137589951-137589973 CGTGGCCTCCACCTCCGGCAGGG + Intronic
1062656431 9:137606292-137606314 CCAGGCGTCCACCTCGGCGGGGG - Intronic
1186448748 X:9654603-9654625 CTTGGCCTCCACCTCGGCGAGGG + Intronic
1190276927 X:48904870-48904892 CTTTGGCTGCACCTCGGGGAAGG + Exonic
1192991795 X:76467342-76467364 CTTGGCCTCCAGCTAGGAGGTGG + Intergenic
1196512824 X:116532355-116532377 CCTGGCCTCCAGGTCTGCGATGG + Intergenic
1199679790 X:150216623-150216645 GTTGGCCTCCAGCTCTGTGAGGG + Intergenic
1199695438 X:150340426-150340448 GTTGGCCTCCAGCTCTGTGAGGG - Intergenic
1201182068 Y:11358464-11358486 CTAGGCCTCCAACTCTGTGATGG + Intergenic