ID: 1186451307

View in Genome Browser
Species Human (GRCh38)
Location X:9676127-9676149
Sequence TGGATTCAATATTTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186451307_1186451310 -2 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451310 X:9676148-9676170 CAGAATTCATGAGTGTTCCAAGG No data
1186451307_1186451311 4 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451311 X:9676154-9676176 TCATGAGTGTTCCAAGGTGCTGG No data
1186451307_1186451316 27 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451316 X:9676177-9676199 AGACCACACTGTAGGGCTGGAGG No data
1186451307_1186451313 19 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG No data
1186451307_1186451314 20 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451314 X:9676170-9676192 GTGCTGGAGACCACACTGTAGGG No data
1186451307_1186451315 24 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451315 X:9676174-9676196 TGGAGACCACACTGTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186451307 Original CRISPR TGGATTCAATATTTGGAAAT TGG (reversed) Intronic