ID: 1186451309

View in Genome Browser
Species Human (GRCh38)
Location X:9676147-9676169
Sequence CTTGGAACACTCATGAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186451309_1186451316 7 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG No data
Right 1186451316 X:9676177-9676199 AGACCACACTGTAGGGCTGGAGG No data
1186451309_1186451313 -1 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG No data
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG No data
1186451309_1186451315 4 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG No data
Right 1186451315 X:9676174-9676196 TGGAGACCACACTGTAGGGCTGG No data
1186451309_1186451314 0 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG No data
Right 1186451314 X:9676170-9676192 GTGCTGGAGACCACACTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186451309 Original CRISPR CTTGGAACACTCATGAATTC TGG (reversed) Intronic