ID: 1186451313

View in Genome Browser
Species Human (GRCh38)
Location X:9676169-9676191
Sequence GGTGCTGGAGACCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186451309_1186451313 -1 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG No data
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG No data
1186451308_1186451313 12 Left 1186451308 X:9676134-9676156 CCAAATATTGAATCCAGAATTCA No data
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG No data
1186451307_1186451313 19 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA No data
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186451313 Original CRISPR GGTGCTGGAGACCACACTGT AGG Intronic