ID: 1186451313

View in Genome Browser
Species Human (GRCh38)
Location X:9676169-9676191
Sequence GGTGCTGGAGACCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186451309_1186451313 -1 Left 1186451309 X:9676147-9676169 CCAGAATTCATGAGTGTTCCAAG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG 0: 1
1: 0
2: 4
3: 12
4: 192
1186451307_1186451313 19 Left 1186451307 X:9676127-9676149 CCAATTTCCAAATATTGAATCCA 0: 1
1: 0
2: 2
3: 31
4: 325
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG 0: 1
1: 0
2: 4
3: 12
4: 192
1186451308_1186451313 12 Left 1186451308 X:9676134-9676156 CCAAATATTGAATCCAGAATTCA 0: 1
1: 0
2: 4
3: 30
4: 287
Right 1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG 0: 1
1: 0
2: 4
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186451313 Original CRISPR GGTGCTGGAGACCACACTGT AGG Intronic
900406945 1:2496948-2496970 GTTGCTGGAGTCCACACGGTAGG - Exonic
900528757 1:3142420-3142442 GCAGCTGAGGACCACACTGTCGG - Intronic
900566485 1:3334681-3334703 GGTGGTGGAGGCCACAGTGGTGG - Intronic
900826557 1:4931688-4931710 GGTGCTGGTGACATCACTGTGGG - Intergenic
901776690 1:11565165-11565187 GGTGCAGGAGGCAACCCTGTGGG - Intergenic
904228617 1:29047120-29047142 GGTCCTAGAGATCTCACTGTGGG + Intronic
904679879 1:32221980-32222002 GGTGCTGGTGGCCGCTCTGTGGG - Exonic
905162169 1:36046079-36046101 AGTGCTGGGGACCCCAGTGTAGG - Intronic
905631098 1:39518991-39519013 GGTGCTGGGAACCCCTCTGTAGG - Intronic
905666661 1:39767180-39767202 GGTGCTGGGAACCCCTCTGTAGG + Intronic
906252788 1:44324103-44324125 GGTGCTGGAGATCACACTGAAGG - Intronic
908520554 1:64937086-64937108 GGTCCTGTAGACCAAACTGGGGG - Intronic
908538846 1:65103702-65103724 GGCAATGGTGACCACACTGTGGG + Intergenic
908996502 1:70162369-70162391 TGTTCTGGGGACCACACTTTGGG - Intronic
910461168 1:87449352-87449374 GATTCTGGTGACCTCACTGTAGG + Intergenic
910735982 1:90458242-90458264 AGCCCTGGAGAACACACTGTGGG - Intergenic
911200330 1:95037502-95037524 GCTGCTGGAGGCAGCACTGTGGG + Intronic
911422451 1:97661279-97661301 GGAGGTGGAGAGAACACTGTAGG - Intronic
912461435 1:109834798-109834820 GGTGCTGCAGACCCCGCTTTGGG + Intergenic
913327645 1:117640837-117640859 GATGCTGGAGGCCACACACTTGG - Intergenic
914318401 1:146535682-146535704 GATTCTGGTGACCTCACTGTAGG + Intergenic
914495959 1:148197675-148197697 GATTCTGGTGACCTCACTGTAGG - Intergenic
915602447 1:156930698-156930720 GGGGCTGGAGACCACATTCCAGG - Intronic
919754968 1:201061010-201061032 GGTGCTATAGACTAGACTGTGGG + Intronic
919800454 1:201350958-201350980 GGTGCTGGAGAGAACGGTGTGGG + Intergenic
922653259 1:227359022-227359044 GGTGCTGGCTGACACACTGTGGG + Intergenic
1065798488 10:29329275-29329297 GGTGGGGGAGACCAAAATGTGGG - Intergenic
1067088102 10:43253374-43253396 GGTTCTGGAGATCAGGCTGTGGG - Intronic
1067866377 10:49911742-49911764 TGTGCTAGAGACCAGAATGTAGG + Intronic
1072532547 10:96332790-96332812 GGTGTTGGGGACCACACACTGGG - Intronic
1072915506 10:99535372-99535394 GGCGCTGGCGCCCACGCTGTAGG - Exonic
1073179350 10:101574531-101574553 GGTGCTGGAGTCCCTACTGCAGG - Intronic
1075508062 10:123043605-123043627 GATGCTGGAGAACTCCCTGTAGG + Intronic
1075906021 10:126082842-126082864 GGGGCAGGGGACCACAGTGTGGG + Intronic
1076725057 10:132409331-132409353 GGTGGTGGAGACCAGGCTCTGGG + Intronic
1079464238 11:20713604-20713626 GGAGCTGCTGACCACAATGTGGG - Intronic
1080626719 11:34037232-34037254 GGTGTTGCAGCCCACACTGCTGG - Intergenic
1082640183 11:55650267-55650289 AGGGCTCGAGACCACACTGGTGG + Intergenic
1083142424 11:60733143-60733165 TTTGCTGGAGACCACACAGCCGG + Intronic
1083314269 11:61804639-61804661 GGTGCTGGAGACAAGGATGTGGG + Intronic
1084738897 11:71125292-71125314 GGTGCTGGAGGCCTCACTTTTGG - Intronic
1085882954 11:80489403-80489425 GGGGCTGGAGACCAAACTTTTGG - Intergenic
1088913271 11:114208119-114208141 GGTGCTGGAGACCAGAAGGAGGG - Intronic
1090250074 11:125244896-125244918 GGTGCAGGAGACCACGTGGTGGG + Intronic
1091174489 11:133546535-133546557 GGGGCTGGAGGCCACATTGAAGG - Intergenic
1091175326 11:133552826-133552848 GGTGCTGAAATTCACACTGTGGG - Intergenic
1092161186 12:6316323-6316345 GGTGCTGGGGCCCACCCTGGAGG + Exonic
1095616186 12:44192202-44192224 GCTGCTGAAGACCTCACTGATGG - Intronic
1097573063 12:61356744-61356766 GGGCCTGGTGACCACACTGCTGG + Intergenic
1098902116 12:76123405-76123427 AGTGCTGGACATCACACTGTGGG + Intergenic
1100722017 12:97369247-97369269 GGAGATGGAAACCACACAGTAGG - Intergenic
1102133102 12:110548998-110549020 GGTGCTGAGAACCACAGTGTAGG + Intronic
1102697900 12:114814461-114814483 GGAGCTCGAGACCAGCCTGTGGG - Intergenic
1102713774 12:114952404-114952426 GGTGCAGGAGACCACACTGCGGG - Intergenic
1104646255 12:130499709-130499731 GGTTGGGGAGACCTCACTGTGGG - Intronic
1109737038 13:66499508-66499530 GGTGATGGAGACAATGCTGTTGG + Intronic
1112280216 13:98056282-98056304 GGGGCTGGAGACCAGACAATGGG + Intergenic
1112596702 13:100814254-100814276 GATGATGGAGACCACGCTGCTGG - Intergenic
1113713146 13:112484179-112484201 GGTGCGGTCGCCCACACTGTGGG + Intergenic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1117766526 14:59089118-59089140 GGTGCTGGTGATTACCCTGTGGG - Intergenic
1119998511 14:79278671-79278693 GGTGGTGGATAGGACACTGTTGG - Intronic
1122849827 14:104522077-104522099 GGTTCTGTGGACCACACTGAGGG + Intronic
1122960282 14:105091033-105091055 GGGGCTGGAGACCAGCCTGCTGG - Intergenic
1124462377 15:29904155-29904177 GGTGCTGCAGGCCACAATGAGGG + Intronic
1126800442 15:52293211-52293233 GGAGCTGGAAGCCACCCTGTGGG - Intronic
1127337381 15:58001875-58001897 TGTTCTGGATACCACATTGTAGG + Intronic
1127474894 15:59323932-59323954 GGAGCTGGAGAAGTCACTGTGGG - Intronic
1128189928 15:65682654-65682676 GGTGCAGGAGACCTCACTTTCGG + Intronic
1129895547 15:79102990-79103012 GGTGATGGAGTCCCCACCGTGGG - Intergenic
1131372854 15:91897737-91897759 GCTGCTGGAGCCCACGCTGCAGG - Intronic
1134054749 16:11162853-11162875 CATGCTGCAGACGACACTGTGGG - Intronic
1134095301 16:11414852-11414874 TGTGCTGGAAACCACACTCCAGG - Intronic
1135055984 16:19232449-19232471 GGGGCTGCAGACCACATTTTGGG + Intronic
1135758183 16:25115406-25115428 GGTGCTAGAAATCACACAGTAGG + Intronic
1138335549 16:56250043-56250065 GGGGCTGGAGCAGACACTGTTGG - Intronic
1138506522 16:57480913-57480935 GGTGATGGAGACCAGTCTGTGGG + Intronic
1139823924 16:69742242-69742264 GGTCCTGGAGACGACACGGCTGG + Exonic
1141592409 16:85077588-85077610 GGGGCTGGAGACCAAGCTGAAGG + Exonic
1141627699 16:85269999-85270021 TGTGCCTGAGGCCACACTGTTGG + Intergenic
1142811607 17:2398054-2398076 GGTGGAGGAGTCCACACTGGTGG + Intronic
1143185140 17:5005529-5005551 GGTGCTGAAGGGCACAGTGTGGG + Intronic
1145035537 17:19537871-19537893 GGTGCTGGAGACTTGTCTGTCGG - Intronic
1147372123 17:39999669-39999691 GGTGCAGGAGACCTGACTTTTGG - Intergenic
1147439091 17:40436550-40436572 GGTGTTGGAGATCACTCTGAAGG + Intergenic
1147657809 17:42100612-42100634 GGTGTTTGAGACCAGCCTGTTGG + Intergenic
1153015405 18:578555-578577 AGTGCTGGATACAACACAGTAGG - Intergenic
1153782347 18:8505506-8505528 GGTGATGGAGACCACTATGGGGG + Intergenic
1157264523 18:46206428-46206450 GGGGCTGAAGACCACTCTTTGGG - Intronic
1159990986 18:74907337-74907359 GGTGCTGGACATCAGACTCTGGG + Intronic
1161233248 19:3186051-3186073 GGTGCTGGAGAACATGCTGAAGG + Exonic
1162113573 19:8414628-8414650 GCTGCCTGAGACCACAATGTAGG + Intronic
1162922771 19:13913191-13913213 GGGGCTGGAGACCACCTTGCAGG + Exonic
1165802416 19:38561259-38561281 GGTGCTGCTGACCAACCTGTCGG + Exonic
1166979445 19:46624054-46624076 GGTGCTGGTGACCGGACTGGCGG - Exonic
1168515488 19:57007435-57007457 GGTGCTGTAGCCTAGACTGTAGG + Intergenic
925388758 2:3481842-3481864 GGCGGTGCAGACGACACTGTCGG - Intronic
925451455 2:3973059-3973081 GGTGGTGGAGCCCACACTGTGGG + Intergenic
933669294 2:84991611-84991633 AGGCCTGGAGATCACACTGTGGG + Intronic
934900514 2:98156094-98156116 GGTTCTGAGGACCACACTCTGGG + Intronic
935377026 2:102410144-102410166 GGTGCTAGAGACCCCATTTTGGG + Intergenic
936108370 2:109645023-109645045 GTTGCTGGGGGCCACACAGTCGG - Intergenic
936664417 2:114577635-114577657 GTTGCTGTAAACCACACTCTGGG + Intronic
937429238 2:121824677-121824699 GGTCCTGGGGTCCTCACTGTGGG + Intergenic
940638900 2:156328276-156328298 GGTCCTGGAGGCCATACTGAGGG + Intronic
940887265 2:159000641-159000663 GGTGGTGGAGTCCACACTGTGGG + Intronic
947916582 2:233836105-233836127 GGTGCTGCAGACCTCACAGACGG - Intronic
948013008 2:234664856-234664878 GGTCCTGGAAACAGCACTGTAGG + Intergenic
1172201759 20:33131905-33131927 GGGGCTGGAGAGCTCCCTGTGGG - Intergenic
1173769813 20:45647083-45647105 GGTGCTTGAGTCCACAGGGTTGG + Intergenic
1174325598 20:49776315-49776337 AGTGTTTGAGACCATACTGTAGG + Intergenic
1176693608 21:9947875-9947897 GGTGCTGCAGACCCCATTTTGGG - Intergenic
1178493387 21:33068348-33068370 GGTGCTGGGGGCCCCACTTTGGG - Intergenic
1178607892 21:34055402-34055424 AGTGCTGGAAACCAGACAGTAGG + Intergenic
1179506863 21:41846945-41846967 GGTTCTGGCGACTACATTGTGGG + Intronic
1181010333 22:20036612-20036634 GGAACTGGACACCACACTCTTGG - Intronic
1181307065 22:21922966-21922988 GGTGCTGGGGAAAGCACTGTGGG + Exonic
1181512100 22:23393720-23393742 GGTGCTGGGGGCCACCCCGTGGG + Intergenic
1181745289 22:24951992-24952014 GGTGCTGGAGAACCCAGTGGTGG - Intergenic
1181959002 22:26609577-26609599 GGTGATGGAGAACACATGGTGGG + Intronic
1183463266 22:37965958-37965980 GGTGGTAGAGTCCCCACTGTGGG + Intronic
1183988778 22:41584250-41584272 GGTTCTGGAGACCAGGCTGGTGG + Intronic
1185013606 22:48331007-48331029 CGAACTGGAGACCACGCTGTGGG + Intergenic
1185016101 22:48343606-48343628 GGTGCTGGAGAAGCCGCTGTGGG + Intergenic
1185070201 22:48651885-48651907 GGGGATGGGGACCACACTGATGG + Intronic
950412922 3:12850669-12850691 GGTGTTCCAGGCCACACTGTTGG - Intronic
950471209 3:13187606-13187628 GGTGCTGGCCAGCACACAGTAGG + Intergenic
950754428 3:15161456-15161478 GGAGCAGGAGATCACCCTGTAGG - Intergenic
956750462 3:72340482-72340504 CCTGCTGGAGACCACACAGGTGG - Intergenic
961168429 3:124779431-124779453 GGTGCCTGAGACCACAGGGTAGG - Intronic
961637609 3:128343028-128343050 AGTGCTGGCAACCCCACTGTCGG + Intronic
961716615 3:128861890-128861912 GGTGTTCCAGGCCACACTGTTGG + Intergenic
962843074 3:139252767-139252789 GGTTCCGGGGACCACACTTTGGG - Intronic
966076324 3:175940144-175940166 TGGGCAGCAGACCACACTGTGGG + Intergenic
966897219 3:184454619-184454641 TGTGCTGGAGCCCACACCGCTGG - Intronic
968508285 4:982474-982496 GGTGCTGCTGGCCACACTGCTGG + Intronic
969246100 4:5933866-5933888 GGTCCTGGTGACAAGACTGTTGG + Intronic
971194259 4:24456944-24456966 GATGCTGAAGACCACCCTGATGG + Intergenic
974012292 4:56617950-56617972 GGTTGTGGAGAGCACACTGGTGG - Intergenic
975945064 4:79696083-79696105 GGAGCTGCAGCCCACAGTGTGGG - Intergenic
978407828 4:108398578-108398600 GCTGCTGGAGACCTCGGTGTGGG + Intergenic
987110143 5:14678276-14678298 GGGGCTGGAGCCCACTCAGTGGG + Intronic
997350789 5:133230125-133230147 GGTGCTGGCCACCTCACTGAGGG - Intronic
999204240 5:149836762-149836784 GCTGCTGGAGACCGCCCTGGAGG + Exonic
999771141 5:154776392-154776414 GGTGCTGGAGATTAGACTGGTGG + Intronic
1001426485 5:171625919-171625941 GGTCCTCAGGACCACACTGTTGG - Intergenic
1002179818 5:177425625-177425647 GGTGCTGGAGAACACAGTGATGG - Intronic
1003999772 6:11586936-11586958 GCTGCTGTAGGCCACACTATGGG - Intergenic
1004367921 6:15027578-15027600 GATTCTGGAGCCCACACTCTTGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007745848 6:44042538-44042560 GGCACTGGAGAGCACAGTGTGGG + Intergenic
1011624950 6:89275064-89275086 GGTCCTGGAAAGCACACTTTAGG + Intronic
1012615218 6:101269148-101269170 GATGGTGGAGTCCACACTGGGGG - Intergenic
1013340807 6:109213801-109213823 GGTTCTGGAGGGCACACAGTGGG + Intergenic
1013487138 6:110607855-110607877 GGAGTTGGAGACCACCCTGGGGG + Intergenic
1013666830 6:112358150-112358172 GGTGGTGGTGACAACATTGTGGG - Intergenic
1014959067 6:127659792-127659814 GGTGCTCTAGTTCACACTGTAGG - Intergenic
1016264898 6:142221201-142221223 AGTTCTGGGGACCACACTATGGG + Exonic
1016878821 6:148889883-148889905 GGAGTTGAAGACCAGACTGTAGG - Intronic
1017689976 6:156954823-156954845 GGAACTTGAGACCACACAGTGGG - Intronic
1019511191 7:1418468-1418490 GGTGGTGGAGGGCAGACTGTGGG - Intergenic
1022806089 7:33824060-33824082 CGTGCTGGAGCCCACATTGGTGG + Intergenic
1023869246 7:44254130-44254152 GCTGCTGGAGACCAGATTGAGGG - Intronic
1024516792 7:50266195-50266217 GGTGATGCAGACCACACACTTGG - Intergenic
1026239706 7:68562297-68562319 AGGGCTGGAGAGCACACGGTGGG - Intergenic
1032655702 7:133927227-133927249 GGTGCTGAGGACCAGAATGTAGG - Intronic
1033684531 7:143626195-143626217 GATGGTGGAGAACAGACTGTGGG + Intronic
1033687707 7:143705414-143705436 GATGGTGGAGAACAGACTGTGGG + Intronic
1033700080 7:143831428-143831450 GATGGTGGAGAACAGACTGTGGG - Intergenic
1034283086 7:149866904-149866926 AGTGCTGGAGACCCCCTTGTTGG + Exonic
1034385406 7:150736968-150736990 CGTGATGGAGCCCACCCTGTGGG - Intronic
1035174442 7:157040262-157040284 GGTCCGGGAGCCCACACTGTTGG + Intergenic
1035282507 7:157786911-157786933 GGTGGTGCAGACAGCACTGTGGG - Intronic
1038507805 8:28100877-28100899 GGTGCTGGGGACCATATGGTAGG - Intronic
1040434590 8:47378095-47378117 AGTGCTGGAAACCCCACTCTTGG - Intronic
1045427434 8:102080974-102080996 TGGGCTGGACACCACACTTTGGG - Intronic
1045732564 8:105259108-105259130 TGTGTTGAAGATCACACTGTAGG + Intronic
1049020836 8:139956791-139956813 GGTGTGGGAGGCCACTCTGTAGG - Intronic
1049422060 8:142521390-142521412 GGGGCTGGAGACCACAGGGTAGG - Intronic
1050161007 9:2718521-2718543 GGTGCTGGAGGCCACCCCGATGG - Exonic
1051050868 9:12930166-12930188 GGTGTGGGAGAGGACACTGTTGG + Intergenic
1051080163 9:13284795-13284817 CAGGCTGCAGACCACACTGTGGG + Intergenic
1051653912 9:19359633-19359655 GGTTTTGGAGACCACAGTCTAGG + Intronic
1051910977 9:22154267-22154289 GGTGCTGGAGTACGCACTGGTGG + Intergenic
1053386426 9:37694155-37694177 GGTTTTGCAGACCCCACTGTGGG - Intronic
1053426682 9:38014710-38014732 TGTTCTGGAGGCCACACTGGTGG + Intronic
1054880534 9:70140261-70140283 CGGGCTGGAGACCACACTACAGG + Exonic
1056379506 9:86044462-86044484 GTTGCTGGTGACCACACAGATGG + Intronic
1056816932 9:89808698-89808720 CGTGCTGGAGACCATAGTGTAGG + Intergenic
1056929529 9:90862446-90862468 TGGCCTGGGGACCACACTGTGGG - Intronic
1057836775 9:98451681-98451703 GATGATGCAGACCACACTTTGGG + Intronic
1059374575 9:113872330-113872352 TCTGCTGGAGACCACACCGCAGG + Intergenic
1061490008 9:130939423-130939445 GGGGCTGGAGACCCCACAGCTGG - Intergenic
1062054561 9:134464106-134464128 GCTCCTGGAGACCCCGCTGTAGG + Intergenic
1062198865 9:135290056-135290078 GGAGATAGAAACCACACTGTAGG - Intergenic
1062203171 9:135319499-135319521 GGTGCAGGATTCCACTCTGTGGG - Intergenic
1062317151 9:135973388-135973410 GGTGGTGGAGAGCACAGTTTTGG + Intergenic
1062545891 9:137063644-137063666 GGTGCTGGAGTACGCACTGGTGG - Exonic
1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG + Intronic
1187157666 X:16736287-16736309 TGTGCTAGATACCACACTGAGGG + Intronic
1188399589 X:29728446-29728468 GGTGTTGTAGACCCCACTGGGGG + Intronic
1189097165 X:38152521-38152543 ATTGCTGGAGTCTACACTGTAGG - Intronic
1190161276 X:48033052-48033074 GATGATGGGAACCACACTGTTGG + Intronic
1192054349 X:67758272-67758294 GGTACTCAAGACCACATTGTAGG - Intergenic
1195094928 X:101493351-101493373 GGTGCTGGGGACCAGACTGGTGG + Exonic
1196384105 X:115129232-115129254 CATGCTAGAGACCACACAGTAGG + Intronic
1199679654 X:150215934-150215956 GGCACGGGAGACCACACTGGTGG + Intergenic
1199695577 X:150341115-150341137 GGCACGGGAGACCACACTGGTGG - Intergenic
1201143748 Y:11050183-11050205 GGTGCAGGAGGCCTCACTTTTGG - Intergenic