ID: 1186456959

View in Genome Browser
Species Human (GRCh38)
Location X:9717343-9717365
Sequence GAACCGAAGAAGCCACAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186456957_1186456959 19 Left 1186456957 X:9717301-9717323 CCATCAGACATAGAGAGCTTTGT 0: 1
1: 0
2: 1
3: 16
4: 133
Right 1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186456959 Original CRISPR GAACCGAAGAAGCCACAGGC AGG Exonic
903694071 1:25194743-25194765 GAAACGCAGGAGCGACAGGCCGG + Intergenic
905183642 1:36180909-36180931 GAACTGAAGAAGCCTCGGGCTGG + Intergenic
906224107 1:44106750-44106772 GAAGCTAAGAAGTCACAGACTGG + Intergenic
909766609 1:79364176-79364198 GATCCGAAGAAGGCATAGACAGG + Intergenic
915662825 1:157417940-157417962 GACCCTAAGAGGCCACAGGTGGG + Intergenic
918472188 1:184885770-184885792 GAAAAGAAGCAGCCATAGGCTGG - Intronic
919470168 1:197968669-197968691 GAAGAGAAGAAGCCAGAGCCAGG + Intergenic
922056086 1:222043803-222043825 GGACAGAAGCAGCCGCAGGCTGG + Intergenic
922537285 1:226390572-226390594 GACCCGGAGAAGCCACAGCTAGG - Exonic
923836604 1:237617901-237617923 GAAAGGAAGAAACCACAAGCAGG - Intronic
924657590 1:245987472-245987494 GAACTAAAGAAGCCAGAGCCAGG + Intronic
1063048451 10:2418273-2418295 GAACAGAAGATGCCAGAGCCTGG - Intergenic
1063382372 10:5593817-5593839 GAACCAAAGAAACAAGAGGCGGG - Intergenic
1064440189 10:15346446-15346468 GAAGAGATGGAGCCACAGGCAGG + Intronic
1064715851 10:18175892-18175914 GAACCTAAAAAGCCAGAGGCCGG - Intronic
1067689739 10:48494084-48494106 GAGACCAAGAAGCCAGAGGCTGG + Intronic
1069264257 10:66438356-66438378 GAAAGGCAGAAGCCACAGTCAGG - Intronic
1069437044 10:68393948-68393970 GAAATGAAGAAGTCACAGGGGGG + Intronic
1071408668 10:85364133-85364155 GAACCGAGAAAGCCAAAGGCAGG + Intergenic
1073818443 10:107233338-107233360 GAGCCGAAGCACCCACTGGCAGG + Intergenic
1081589263 11:44409612-44409634 CAACAGAAGAAAGCACAGGCAGG - Intergenic
1081903001 11:46645909-46645931 GAAGCAAAGAAGGCACTGGCAGG + Exonic
1082798149 11:57393550-57393572 GAATCCAAGAAACCACAGGAAGG - Intronic
1083467959 11:62861556-62861578 GAAGGGAAGAAGCCAGAGCCAGG - Intronic
1085008467 11:73117245-73117267 GAAGCTAAGAAGACACAGACGGG + Intronic
1085294393 11:75422802-75422824 GGACAGAGGAAGCCCCAGGCTGG - Intronic
1093333442 12:17871047-17871069 GAACTGAAGAAGACAGAGACAGG + Intergenic
1094798279 12:34001095-34001117 GTACAAAAGAACCCACAGGCTGG + Intergenic
1098307593 12:69117151-69117173 GAACTGAAGATGGCACAGGGAGG - Intergenic
1099294194 12:80809260-80809282 GAAAAGAAGAAGCTACAGGCTGG - Intronic
1100140296 12:91610449-91610471 GATCAGAAGAAGCCACGGCCAGG - Intergenic
1102923376 12:116809144-116809166 GAACTGAAGAACACAGAGGCTGG + Intronic
1103733265 12:123042593-123042615 GAAGCGAGGGAGCCACCGGCAGG + Intronic
1104467637 12:129003798-129003820 GAAGTGCAGAAGCCCCAGGCAGG + Intergenic
1106556608 13:30814408-30814430 GAACAGACAAAGCCACAGACTGG - Intergenic
1113512545 13:110867618-110867640 GAGCCCTGGAAGCCACAGGCCGG + Intergenic
1113630815 13:111882395-111882417 CAAAGGATGAAGCCACAGGCCGG - Intergenic
1114693594 14:24607156-24607178 GATCCAAAGAAGACACAGACCGG - Exonic
1114767872 14:25394982-25395004 GGAAGGAAGAAACCACAGGCAGG - Intergenic
1115436261 14:33378284-33378306 GAACCCTAGAAGCAACAGGAGGG + Intronic
1117061281 14:51966302-51966324 GAACCGAAGGAGGCACTCGCTGG - Intronic
1119272986 14:73326091-73326113 GTACCAAAGAAGGCACAGGAAGG + Intronic
1119877726 14:78074937-78074959 GAGAGGAAGAGGCCACAGGCAGG + Intergenic
1122421949 14:101583242-101583264 GAAAACAAGAAGCCACAGGTAGG - Intergenic
1122455447 14:101846794-101846816 GAAACCAAGAAGCCAGAGGTAGG - Intronic
1132615223 16:837806-837828 GAAAAGAAAAAACCACAGGCCGG - Intergenic
1133303106 16:4795220-4795242 GGAGTGAAGAAGCCACAGGCCGG + Intronic
1133371856 16:5251241-5251263 AAACTGAAGAAGGCAAAGGCAGG - Intergenic
1135668568 16:24355921-24355943 GACCAGAAGAAGGCACAGGGTGG + Intronic
1137642564 16:50045627-50045649 GAACAAAAGAAGCCAGAGACAGG - Intergenic
1138586402 16:57973014-57973036 GAAAAGAAGAAGCCTGAGGCTGG + Intergenic
1140514169 16:75530304-75530326 GAACCGTGGCAGCCACATGCGGG + Exonic
1144478452 17:15609485-15609507 GAGCCCAAGAAGCCACATGGTGG + Intronic
1144919839 17:18754226-18754248 GAGCCCAAGAAGCCACATGGTGG - Intronic
1145991712 17:29083031-29083053 GAGCCAGAGAAGCCACAGGGTGG - Intronic
1146301276 17:31691651-31691673 GACAGGAAGGAGCCACAGGCAGG - Intergenic
1147620518 17:41863643-41863665 GAACAGGAGAAGCCCCAGGATGG - Intronic
1148245920 17:46030801-46030823 GAACCTGAGCAGCCACAGCCAGG + Exonic
1153764795 18:8365280-8365302 GGAAGGAAGAAGCAACAGGCAGG - Intronic
1156126493 18:33911706-33911728 GAAACGAAGAAGCCAGAGGGGGG - Intronic
1156501922 18:37565521-37565543 GAACGGATTAAGCCACAGCCCGG - Exonic
1157596646 18:48868142-48868164 GCACAGCAGATGCCACAGGCAGG - Intergenic
1162564601 19:11438432-11438454 AAACCGAAACACCCACAGGCAGG + Intronic
1163507585 19:17717466-17717488 TAACAGAAGAAATCACAGGCAGG + Intergenic
1163659708 19:18569384-18569406 GGACTGAAGAAGCCACAGCTAGG - Intronic
1167357076 19:49010732-49010754 GAACAGAGGCAGCCACGGGCCGG - Intronic
1167493676 19:49805965-49805987 GAAGCAAAGCAGCCATAGGCCGG - Intronic
1168259377 19:55184927-55184949 GAAAGGATGAAGCCACAGGATGG - Intronic
927651977 2:24918832-24918854 GAAGCGAGGCAGGCACAGGCAGG + Exonic
928612423 2:33003608-33003630 GAAGAAAAGAAGTCACAGGCAGG + Intronic
928704613 2:33934526-33934548 GAACAGAAGATACCAGAGGCTGG - Intergenic
930366677 2:50447806-50447828 CAACTGAAGAAGCCATAAGCAGG - Intronic
931739224 2:65227480-65227502 GAACTGCAGAAGACGCAGGCAGG - Intergenic
932322967 2:70835373-70835395 CAAATGAAAAAGCCACAGGCAGG + Intronic
932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG + Intronic
935442218 2:103113028-103113050 GAAATGAAGAAGCCACTGACTGG + Intergenic
937839851 2:126514058-126514080 GAACCAAAGAAGCCTCTTGCAGG + Intergenic
938119534 2:128623884-128623906 GGACCGACGAAATCACAGGCAGG - Intergenic
941039041 2:160599787-160599809 GCACCTAAGCAGCCCCAGGCTGG + Intergenic
942297685 2:174533638-174533660 GAACCAAGGAGGCCACAGTCTGG + Intergenic
942876857 2:180810904-180810926 GAAATGAAGAAGCGACAGGTTGG - Intergenic
1171106136 20:22434609-22434631 GAATCTAAACAGCCACAGGCTGG + Intergenic
1171865790 20:30486819-30486841 GAACTGAAAAACCCAAAGGCTGG + Intergenic
1172623145 20:36332634-36332656 GCACCCAAGATGGCACAGGCGGG - Intronic
1175496159 20:59415731-59415753 GAACTGGAGAAGTCACAGGATGG + Intergenic
1179244214 21:39616479-39616501 CAAGTGAAGAAGCCACAGTCTGG - Intronic
1179577220 21:42315492-42315514 GAACAGGAGCAGCCACAGCCAGG - Exonic
1180723231 22:17925032-17925054 GATCCGAATAAGCCACAAACTGG + Intronic
1181363816 22:22358351-22358373 CAGCAGCAGAAGCCACAGGCCGG - Intergenic
1182550851 22:31100091-31100113 GGAACGAAGGAGCCGCAGGCCGG + Intronic
1183746655 22:39695619-39695641 GAACCGAAGATGCCACCCTCTGG + Intergenic
1184299287 22:43545789-43545811 GAACCGAAGCAGCGTCGGGCTGG + Intronic
949921654 3:9008020-9008042 GGAAGGAAGAAGCCACAGTCTGG - Intronic
950424205 3:12915837-12915859 GAACCAAAGAACTCCCAGGCAGG + Intronic
958411473 3:93822103-93822125 GAACAGAAGATACTACAGGCTGG + Intergenic
959865118 3:111258429-111258451 GAAAAAAAGAAGCCACAGGTTGG - Intronic
962856589 3:139351713-139351735 GAACAGTATAAGCAACAGGCAGG + Intronic
968079775 3:195837844-195837866 CAGCCCAAGAAGCCACAGGCAGG + Intergenic
968867038 4:3219694-3219716 GCACAGAAGAATCCAGAGGCAGG - Intronic
969274090 4:6123522-6123544 AAAAAGAAGAAGCCTCAGGCTGG + Intronic
969523932 4:7694662-7694684 GAACAGAAGAAGCAGCAGGGAGG - Intronic
975638818 4:76478460-76478482 GAAAGGCAGAAGCCCCAGGCAGG + Intronic
979928243 4:126595099-126595121 TTACAGAAGAAGCCACAGGAGGG - Intergenic
982571216 4:157052614-157052636 GAACGGAAGAAGCTGCTGGCTGG + Intergenic
983941431 4:173538032-173538054 GAACGGAAGAAACCAGAGGCAGG - Intergenic
986103776 5:4640161-4640183 GAACCCAAGAAACCACGGGCAGG - Intergenic
986106413 5:4663606-4663628 TAACAGAAGCAGCCACAGCCTGG - Intergenic
987370415 5:17187776-17187798 GAAGCAAGGAAGCCACAGGGTGG + Intronic
987884533 5:23797127-23797149 GAACTAAAGAAGCTACAGGCCGG + Intergenic
990889526 5:60632932-60632954 CAGCAGAATAAGCCACAGGCTGG + Intronic
994468578 5:100171544-100171566 GAACCGAAGGAGCAAAAGGCTGG + Intergenic
1000185734 5:158856055-158856077 GAAAAGAAGAAGCTACAGGCAGG + Intronic
1001057684 5:168462737-168462759 GAACAGGAGAATCCAGAGGCTGG + Intronic
1006603817 6:35242763-35242785 GAGCCGAAGAAACCACAGGTGGG + Exonic
1008130235 6:47712939-47712961 GATCCTAAGAGGCCACAGCCCGG - Intronic
1008366889 6:50691574-50691596 GAACCAAAAAAGGCACAGGAAGG - Intergenic
1009775240 6:68196888-68196910 GTACCTAAGAAGCCTAAGGCAGG + Intergenic
1012748626 6:103127508-103127530 GAAACCAAGAACCCACAGGAAGG - Intergenic
1022756488 7:33297706-33297728 GAACAGAAAAAGCCAAAAGCAGG + Intronic
1023526722 7:41111668-41111690 GAACCGAAGATACTACAGGCTGG - Intergenic
1024758858 7:52569497-52569519 AAAGGGAAGAGGCCACAGGCAGG - Intergenic
1025040929 7:55645216-55645238 GACCAGAAGAAGCCTCAGCCGGG - Intergenic
1026910654 7:74089927-74089949 GAGCCACAGAAGCCACAGGAGGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029465389 7:100721567-100721589 GGACAGGAGAAGCCACAGCCAGG - Exonic
1031100955 7:117479598-117479620 GGACAGAAGAAGCCACCGGCGGG - Intronic
1035118975 7:156549170-156549192 GAAACCAACAAGCCACAGCCTGG + Intergenic
1036893459 8:12611394-12611416 CAACCAAAGAAGCCACATGGAGG + Intergenic
1040009539 8:42649819-42649841 TAACTGATGAAGACACAGGCTGG - Intergenic
1041725101 8:61010898-61010920 GCACCGCAGAAGCCCCAGCCAGG - Intergenic
1044119202 8:88374008-88374030 GAGCAGAGGAAGCCACAGTCTGG - Intergenic
1048933678 8:139337846-139337868 GAACCGAAACAGTCAAAGGCAGG - Intergenic
1049110040 8:140636434-140636456 GAAAGGAGGTAGCCACAGGCTGG - Intergenic
1049652011 8:143774255-143774277 GAAGAAAAGAAGCCACAGGCAGG + Intergenic
1051014479 9:12458960-12458982 GAAATGAGGAAGCCAGAGGCAGG - Intergenic
1053136860 9:35656503-35656525 GAGCCTAACAGGCCACAGGCTGG - Intergenic
1056019164 9:82423548-82423570 GCACTTAAGAAGCCACAGGCAGG + Intergenic
1059260457 9:112971119-112971141 GAAACGAAGTAGCCACAGGGTGG + Intergenic
1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG + Exonic
1187517071 X:19982144-19982166 GCAACAAAGAAGCCTCAGGCTGG + Intergenic
1189282583 X:39829236-39829258 GAACCAAAGAAGCTCAAGGCAGG + Intergenic
1189775667 X:44468401-44468423 AACTCGAAGAAGCCACTGGCAGG + Intergenic
1190751554 X:53366394-53366416 TAACTGAAGAGTCCACAGGCAGG + Intergenic
1190804012 X:53818073-53818095 TAACTGAAGAGTCCACAGGCAGG + Intergenic
1192009287 X:67250679-67250701 GAAAGGAAGAAGCCCCAGTCCGG + Intergenic
1192343737 X:70284271-70284293 GAAGGGCAGAAGCCACACGCCGG - Exonic
1194627898 X:96247501-96247523 GAACTAAAGAGTCCACAGGCTGG + Intergenic
1200162426 X:154016386-154016408 GAGGAGGAGAAGCCACAGGCAGG - Intronic
1200696060 Y:6361710-6361732 CAACCAAAGATTCCACAGGCAGG - Intergenic
1200767520 Y:7092896-7092918 GAACTGAAGAAGCCACAGTTGGG + Intergenic
1201039217 Y:9812996-9813018 CAACCAAAGATTCCACAGGCAGG + Intergenic