ID: 1186456984

View in Genome Browser
Species Human (GRCh38)
Location X:9717427-9717449
Sequence TGGACAAGGGTCAGTCTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186456977_1186456984 8 Left 1186456977 X:9717396-9717418 CCTCAGGAAAGGTGGTCAGGAAA 0: 1
1: 0
2: 4
3: 29
4: 275
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456968_1186456984 26 Left 1186456968 X:9717378-9717400 CCCTGGCTTTCCCCTCAGCCTCA 0: 1
1: 1
2: 3
3: 57
4: 521
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456972_1186456984 16 Left 1186456972 X:9717388-9717410 CCCCTCAGCCTCAGGAAAGGTGG 0: 1
1: 1
2: 4
3: 31
4: 262
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456969_1186456984 25 Left 1186456969 X:9717379-9717401 CCTGGCTTTCCCCTCAGCCTCAG 0: 1
1: 1
2: 0
3: 60
4: 533
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456975_1186456984 14 Left 1186456975 X:9717390-9717412 CCTCAGCCTCAGGAAAGGTGGTC 0: 1
1: 1
2: 1
3: 21
4: 237
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456967_1186456984 27 Left 1186456967 X:9717377-9717399 CCCCTGGCTTTCCCCTCAGCCTC 0: 1
1: 0
2: 4
3: 58
4: 586
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103
1186456974_1186456984 15 Left 1186456974 X:9717389-9717411 CCCTCAGCCTCAGGAAAGGTGGT 0: 1
1: 1
2: 2
3: 18
4: 215
Right 1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186456984 Original CRISPR TGGACAAGGGTCAGTCTTCG GGG Exonic
902250325 1:15150812-15150834 TGGACAAGGGTCAGTAGCCAAGG - Intergenic
903406244 1:23098995-23099017 TGGACAGGGAGCAGTATTCGGGG - Intronic
903850342 1:26301889-26301911 GAGACAAGGGACAGGCTTCGAGG + Intronic
911978260 1:104531396-104531418 TGGACAAGGGTCATACTCCTGGG - Intergenic
921108383 1:212007954-212007976 TGGATTAGGGTTAGTCTTCATGG - Intronic
921726385 1:218528551-218528573 TGGTCAAGGTTCAGTCTCTGGGG + Intergenic
922696708 1:227734652-227734674 TGCACAAGTGCCAGTCTTTGAGG + Exonic
1063388954 10:5636030-5636052 TGGACAATGGTGCGTCTTCTAGG - Intergenic
1064952471 10:20869324-20869346 TGGACAAAGGTAAGTGTTGGTGG + Intronic
1065097043 10:22291929-22291951 TGTTCAAGGGTCAGTCATGGTGG + Intergenic
1067817818 10:49495987-49496009 TGAGCAGAGGTCAGTCTTCGTGG - Intronic
1070591107 10:77801799-77801821 AGGACATGAGTCAGTCTTTGGGG - Intronic
1072210569 10:93242855-93242877 TGGATAAGGGACAGACTTGGAGG + Intergenic
1072842675 10:98792778-98792800 TGGGTAAGGGCCAGTCTTCGTGG - Intronic
1074870217 10:117570210-117570232 TGGGCTGGGGTCAGTCTTCTAGG + Intergenic
1078323526 11:10358611-10358633 AGGACAAGTCTCAGTTTTCGGGG + Intronic
1078628289 11:12978538-12978560 TGGACCCGGGTCCGTCTTCAAGG + Intergenic
1080751189 11:35151922-35151944 TGAACAAGGGCCAGACTTCCTGG + Intronic
1081943038 11:46961347-46961369 TGGCCAAGGGTTTGTCTTCTTGG + Intronic
1086227928 11:84534924-84534946 TGGACATTGGTCAATATTCGTGG - Intronic
1086672653 11:89566947-89566969 TGGAGAAGTGTCAGCCTTTGGGG + Intergenic
1095225487 12:39672636-39672658 TGTACCAGGGGCAGTCTTCCTGG + Intronic
1100389414 12:94135103-94135125 GGGGCAAGGGTCATTCTTTGAGG - Intergenic
1103889467 12:124227928-124227950 TGGGCAGGGGCCAGCCTTCGGGG - Intronic
1104982617 12:132580995-132581017 TGGACACGGTTCTGTCTTGGAGG - Intronic
1109207585 13:59499398-59499420 TGGACACGGATCAGACTTCAGGG + Intergenic
1110964424 13:81675400-81675422 TGGACAAAGGTCAGAATTCAGGG - Intergenic
1113896916 13:113770449-113770471 TGCCCAAGGGTCAGTCTCCTGGG - Intronic
1118776656 14:68978163-68978185 AGAACGAGGGTCAGTCTTAGGGG - Intronic
1119196930 14:72723951-72723973 TGGAAAAAGGTCAGTGTTCTGGG - Intronic
1120488748 14:85149270-85149292 TAGTCAAGGGTCAGTCTGTGAGG + Intergenic
1132082715 15:98881129-98881151 TGGAAAAGGGTCAGGCATCCAGG - Intronic
1132676609 16:1123750-1123772 TGTACAAGGGTCTGTCCTGGGGG - Intergenic
1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1137524449 16:49222229-49222251 TGAGCAAGGGTCAGTCATCCTGG - Intergenic
1137574878 16:49592963-49592985 TGGAGAAGGGTCAGTCATCCAGG + Intronic
1139624673 16:68176899-68176921 TGGACAGGGGACTGTCTTTGTGG + Intronic
1141921571 16:87139100-87139122 TGGACAGGGGTCAGAGTTAGAGG - Intronic
1142471636 17:166321-166343 TGGACAGAGGTCAGGCTCCGTGG - Intronic
1145870809 17:28271577-28271599 TGGAGAAGATTCAGTCTTCTTGG + Intergenic
1146811459 17:35907115-35907137 TGGAGAAGAGTCAGTGTCCGTGG + Intergenic
1147317144 17:39626504-39626526 AGGACACGTGTCAGTCATCGTGG - Intergenic
1148434911 17:47676072-47676094 TGGACAAGAGTCAGTATTGCTGG + Intronic
1150849586 17:68691928-68691950 AAGACAAGGGTCAGTCCTGGAGG + Intergenic
1155755083 18:29483064-29483086 TGGACATGGGAAAGTCTTCATGG + Intergenic
1156518658 18:37702445-37702467 TGCTCAGGGGTCAGTCTTGGCGG + Intergenic
1157617169 18:48993872-48993894 CGGACAAGAGTGAGTCTTCAGGG + Intergenic
1164624386 19:29716490-29716512 TGGAAAAGGGTCCGTCCTCTGGG - Intergenic
1166348886 19:42184615-42184637 GGGACAAGGGTGTGTCTTGGGGG - Intronic
925005793 2:442189-442211 TGCACACGGGTGAGTCTTCAGGG + Intergenic
925005820 2:442375-442397 TGCACACGGGTGAGTCTTCAGGG + Intergenic
925005862 2:442655-442677 TGCACACGGGTGAGTCTTCAGGG + Intergenic
925005901 2:442935-442957 TGCACACGGGTGAGTCTTCAGGG + Intergenic
927031685 2:19126553-19126575 TAGAGAAGAGTCAGTATTCGGGG + Intergenic
929944676 2:46361485-46361507 TGGAAGAGGGTCAGTCTCCAGGG - Intronic
932030727 2:68181545-68181567 TGTACAAGGGCCAGTCTTGCAGG + Intronic
935851916 2:107230923-107230945 TGGACAAAAGGCAGTGTTCGTGG - Intergenic
937324759 2:120983855-120983877 TGGACAAGAGCCAGCCTTAGAGG + Intronic
938583577 2:132669258-132669280 TCGACTAGGGTCAGTGGTCGGGG + Intronic
946227901 2:218274323-218274345 GGGACAAGGGTCAGTCTGTCGGG - Exonic
946948844 2:224850475-224850497 GGGACAACGGTCAGTGTTTGCGG + Intronic
948546132 2:238730178-238730200 TGGCCAAGGCTCAGGCTTCAGGG - Intergenic
948709036 2:239813916-239813938 TGGCCAAGGGCCAGTCCTGGTGG - Intergenic
1170359588 20:15530319-15530341 TGAACATGGGTCAGTTTTCAAGG + Intronic
1172614358 20:36273811-36273833 TGAACAAGGGCCAGGCTTGGTGG + Intergenic
1175817453 20:61890882-61890904 TGGACAAGACTCAGTCCTCATGG + Intronic
1178390434 21:32193290-32193312 TGGACAAAGGACTGTGTTCGTGG + Intergenic
957136642 3:76296715-76296737 TGAAATAGGGTCACTCTTCGGGG + Intronic
961979238 3:131059125-131059147 TGGAGAAGTATCAGTCTTCTTGG + Intronic
964390196 3:156188917-156188939 TGGAGAAGGGTGAGTCGTGGTGG + Intronic
965104651 3:164341245-164341267 TGGAAGACGGTCACTCTTCGGGG + Intergenic
972359378 4:38313562-38313584 TGGACAAGAGTCAGACTCCTGGG + Intergenic
973102690 4:46292802-46292824 TGGTCAAGGGTATGTCTTCTAGG - Intronic
974884539 4:67802371-67802393 TGGCAGAGGGTCAGTCTTGGTGG - Intergenic
985206147 4:187539094-187539116 TGGACAAGGGATAGTCTGCATGG + Intergenic
986714561 5:10513575-10513597 TGGCCAAGGGTCATTGTTCTAGG - Intronic
987844572 5:23265832-23265854 TGGACAGGGGTCACTCCTTGAGG + Intergenic
990103707 5:52228520-52228542 TGTACAAAAGTCAGTCTTTGAGG + Intergenic
990478354 5:56184103-56184125 TCGGCAAGGGTCAGTCCTCAGGG - Intronic
991204433 5:64034103-64034125 TGGCCAAGTATCAGTCTTAGAGG - Intergenic
993054139 5:82961670-82961692 TGGACATGGGGCAGCCTTCTGGG + Intergenic
999280723 5:150363671-150363693 TGGAAGAGGGGCAATCTTCGAGG + Intronic
999820556 5:155223678-155223700 TGGACAAGTATCATTCTTCAGGG + Intergenic
1006427319 6:33974591-33974613 TGGACAAAAGGCAGTCTTCATGG + Intergenic
1007280878 6:40711379-40711401 TGGACAGGTGTCTGTCTTTGTGG - Intergenic
1008412553 6:51197287-51197309 TTAGCAAGGGTCACTCTTCGAGG - Intergenic
1011483744 6:87820603-87820625 TGGACAATGTTCAGTCCTCAGGG - Intergenic
1019532620 7:1511239-1511261 TGGACGTGGGTCTGTCTTTGGGG - Intergenic
1019726004 7:2603057-2603079 TGGACAAGGGTGTGTCTGTGGGG - Intronic
1020141699 7:5615304-5615326 TGGACAAGGGTCAGGCAATGAGG + Intergenic
1022257876 7:28677461-28677483 AGGCCAAGGGTCAGCCTTCAAGG + Intronic
1023771051 7:43557030-43557052 TGGACAGGGGTCACTATTCAGGG - Intronic
1023912056 7:44563253-44563275 TGGACAAGGCACAGTCTATGAGG - Intergenic
1038421448 8:27436586-27436608 TGGAGAAGGGTCAGTATTCTTGG + Intronic
1039017698 8:33170728-33170750 TGGACACTGGTCAGTCTTTTAGG - Intergenic
1044141017 8:88652929-88652951 TGGTCACGGGTCAGTTTTCCGGG - Intergenic
1045489637 8:102658277-102658299 TGGGCAAGGGTAAGTCTGGGTGG - Intergenic
1049759544 8:144325913-144325935 CGGACAAGGGGCAGTGTTAGAGG - Intronic
1057866607 9:98686750-98686772 TGGACAAGGGGCAGGGTTTGTGG - Intronic
1058952178 9:109914190-109914212 TTGACAAGGATCAGTCTTTAGGG - Intronic
1061236123 9:129343589-129343611 TGGGCAGGGGTCAGTCTGGGCGG + Intergenic
1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG + Exonic
1187575250 X:20546997-20547019 AGGACAAGGGTCACTCTCAGAGG + Intergenic
1194659377 X:96612729-96612751 TGAACAAGGGTGAGTCTCCAGGG + Intergenic
1197183112 X:123558040-123558062 TGCACAAGTGTTTGTCTTCGAGG - Intergenic
1201234599 Y:11897099-11897121 TGGTCAACAGTCAGTCTTCCTGG + Intergenic