ID: 1186459837

View in Genome Browser
Species Human (GRCh38)
Location X:9739543-9739565
Sequence CCCGGAAGCAGGGTTTTCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186459827_1186459837 -2 Left 1186459827 X:9739522-9739544 CCCACCCACTTGAGACACCTTCC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459830_1186459837 -6 Left 1186459830 X:9739526-9739548 CCCACTTGAGACACCTTCCCGGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459831_1186459837 -7 Left 1186459831 X:9739527-9739549 CCACTTGAGACACCTTCCCGGAA 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459828_1186459837 -3 Left 1186459828 X:9739523-9739545 CCACCCACTTGAGACACCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186459837 Original CRISPR CCCGGAAGCAGGGTTTTCAT GGG Exonic
905386995 1:37611921-37611943 CCCGGCAGCAGTGTTGTCACAGG - Exonic
911034143 1:93520965-93520987 CCCGGAGGCAGAGGTTTCAGTGG + Intronic
912396233 1:109346236-109346258 CCGGGATGCAGAGTTTTCAGTGG + Intronic
917765953 1:178217342-178217364 GGAGGAAGCAGGGTTTACATGGG - Intronic
920366528 1:205450886-205450908 GGAGGAAGCAGGGTTTTCCTCGG - Intronic
924215729 1:241819821-241819843 TCCAGAAACAGCGTTTTCATTGG - Intergenic
1063829929 10:9940859-9940881 CCAGGAATCAAGGTTTTCCTGGG + Intergenic
1067179779 10:43975983-43976005 GCAGGAAGCAGGCTTTTCTTGGG + Intergenic
1069691673 10:70357653-70357675 CCAGGAAGGAGGGTTTTTTTTGG - Intronic
1076551609 10:131281838-131281860 CCGGCCAGAAGGGTTTTCATTGG - Intronic
1077568597 11:3319800-3319822 CCCGGAAGCAGGCTGATCACAGG + Intergenic
1080201911 11:29681614-29681636 CCTGCAGGCAGGGTTTTCTTAGG + Intergenic
1080813452 11:35729184-35729206 TCCAGAAGCAGGCTTTTCTTGGG - Intronic
1080819574 11:35792586-35792608 CCCAGAAGGAGGGATTTCACTGG - Intronic
1087652012 11:100878791-100878813 CCAGGAAGCAGTGTTGTAATGGG - Intronic
1090451821 11:126812901-126812923 CCGGGAAGCTGGGCTCTCATTGG + Intronic
1091851127 12:3697883-3697905 CCCTGAAGGAGTGTTTTCAGAGG + Intronic
1092779641 12:11973570-11973592 CCCACAAGCCGTGTTTTCATAGG + Intergenic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1100491586 12:95085010-95085032 CCCTACAGCAGTGTTTTCATAGG + Intronic
1102038762 12:109787234-109787256 CCAGAAATCTGGGTTTTCATAGG + Intronic
1107963560 13:45579613-45579635 CCTGGAAGCAGGGTTTGACTGGG - Intronic
1109104743 13:58236865-58236887 CCAGGAGGCATTGTTTTCATAGG - Intergenic
1111639517 13:90949081-90949103 CCTGGAAGCAGACTTTTCAGTGG + Intergenic
1113019898 13:105873263-105873285 CCTGGAAGTGGGGTTTTGATGGG - Intergenic
1114665761 14:24376414-24376436 TTCGCAAGCAGGGTCTTCATGGG - Exonic
1116178183 14:41500361-41500383 CTCGGAAACAAAGTTTTCATTGG + Intergenic
1117027451 14:51636168-51636190 CCCGGAGCCAGGGTTTATATAGG + Intronic
1117483810 14:56173974-56173996 CCAGGAAGCAGAGGTTTCAGTGG - Intronic
1118948467 14:70411360-70411382 CCAGGAAGCAGGCTTTACCTAGG - Intronic
1119936837 14:78599847-78599869 CCAGGCAGCAAGCTTTTCATGGG - Intronic
1120123288 14:80709211-80709233 CCGGGAAGCAGAGTTTGCAGTGG - Intronic
1123466053 15:20516827-20516849 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123760844 15:23431414-23431436 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124276777 15:28332803-28332825 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1126106519 15:45150495-45150517 CCCGAAAGCAGGGCCTCCATTGG + Intronic
1127208323 15:56743858-56743880 CCAGGAGGCAGAGTTTTCAGTGG + Intronic
1131605679 15:93900608-93900630 CCGGGGAGCGGGGTTTTTATGGG + Intergenic
1141190742 16:81822918-81822940 CCAGGAAGCAGGTTTTCCCTCGG + Intronic
1144047591 17:11467793-11467815 CCTGAAAGCAGGGTTTGCTTTGG + Intronic
1144305612 17:13966904-13966926 CCATGAAGCAGGGTTTTTGTTGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1203173921 17_GL000205v2_random:177676-177698 CCAGGAAGCAGAGATTACATTGG - Intergenic
1154998490 18:21664122-21664144 CCTGGCAGCAGGGGTTTCAATGG - Exonic
1156337651 18:36185421-36185443 CCAGGAAGCAGGGCTTTAAAAGG + Intergenic
1157442895 18:47723970-47723992 CCGGGAAGCAGGGCTTTGAATGG - Intergenic
1158077541 18:53548195-53548217 CCAGGAAGCAGTTTTCTCATGGG - Intergenic
1159067390 18:63585521-63585543 CCCTGAAGCAGAGTATTGATAGG - Intergenic
1161444617 19:4311187-4311209 CCTGGAAACAGGGTTTTCCCAGG - Intronic
1161514993 19:4691512-4691534 CCAGGAATCTGGATTTTCATTGG + Intronic
1163636570 19:18439669-18439691 CCCGGAATGAGGGTCTTCAAGGG - Intergenic
925877944 2:8328302-8328324 CAGGGCAGTAGGGTTTTCATCGG - Intergenic
929979160 2:46662881-46662903 CCTGGTAGCAGGGATTTAATAGG - Intergenic
930089109 2:47519038-47519060 CCTGAAAGCATGGTTTTCACAGG + Exonic
932115481 2:69042826-69042848 ACTGGATGCAGGGGTTTCATTGG + Intronic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
934767894 2:96890588-96890610 CCCAGAACCAGGGTCTTCTTGGG - Intronic
937986504 2:127640478-127640500 CCCGGAAGGGTGGTTCTCATGGG - Intronic
943769419 2:191700159-191700181 CCCTGAGGCATGGTTTTTATAGG - Intergenic
946313938 2:218897465-218897487 CCCGGAAACTGGGGTTTCGTGGG - Intronic
1170439384 20:16363275-16363297 CTCTGAAGCAGTTTTTTCATTGG - Intronic
1172727319 20:37055484-37055506 CCTGGAAGCAGTGTTTTGAGAGG - Intronic
1173957868 20:47048395-47048417 CCCAAAATCTGGGTTTTCATGGG + Intronic
1175326889 20:58135859-58135881 CCCGTAAGCTGGGTGGTCATGGG - Intergenic
1176118945 20:63445544-63445566 CCCGGATGCAGGGTCTCCAGAGG - Intronic
1182166547 22:28180066-28180088 CCTGATTGCAGGGTTTTCATGGG + Intronic
1184818661 22:46892200-46892222 CCTAGAAGCAGGGTTTGCAGAGG - Intronic
1185125192 22:49006707-49006729 CCCTGGAGCAGGGTTGACATGGG - Intergenic
951701647 3:25502897-25502919 CCTGGAGGCAGTGGTTTCATAGG - Intronic
954109228 3:48424931-48424953 CCAGGAAGCAGGGTCTGGATGGG + Intronic
955052549 3:55426493-55426515 CCCAGAAGAAGGGTTCACATGGG - Intergenic
957672404 3:83322751-83322773 TCCGGAAGCAGACTTTTCACTGG - Intergenic
958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG + Intergenic
963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG + Intronic
963662764 3:148148534-148148556 CTCGGAAGCTGGTTTTTTATGGG + Intergenic
964381192 3:156099985-156100007 CCCTGAATCAGGGTGTTGATTGG - Intronic
964494698 3:157275738-157275760 CCCAGAAGCAGTGTTTTCAAGGG - Intronic
964944247 3:162199573-162199595 CCGGGAAGCAGAGCTTTCAGTGG + Intergenic
965119935 3:164541196-164541218 CCAGGAAGCAGAGGTTGCATTGG + Intergenic
970274228 4:14380295-14380317 CCCTGGAGCAGGTTTTTGATAGG + Intergenic
972329372 4:38050233-38050255 CCCTGGAGCAGGGTTATAATGGG + Intronic
975772184 4:77738034-77738056 CTTGGAAGGAGGGTTTTCAGAGG - Intronic
977484526 4:97625382-97625404 CCAGGAAGCAGAGGTTGCATGGG - Intronic
981518059 4:145632348-145632370 ACTGGAAGCAGGCTTTTCAGTGG - Intronic
985991882 5:3569148-3569170 CTCGGAACCAGAGTTTCCATGGG - Intergenic
987125895 5:14812417-14812439 TCTGGAAGCAGGTTTTGCATGGG + Intronic
989350601 5:40481440-40481462 CCAGGCAGAAGGGATTTCATGGG - Intergenic
992895324 5:81240289-81240311 CCCTTAAGCAGGGTTTCCATAGG - Intronic
993054227 5:82963183-82963205 CATGGAAGCAAGGTCTTCATGGG - Intergenic
997624655 5:135323712-135323734 CCCAGATGCATGATTTTCATGGG - Intronic
999714862 5:154352498-154352520 CCCAGCTGCAGGGTTTTCATGGG - Intronic
1001156687 5:169278597-169278619 AGCAGAAGCAGGGTTTTCTTTGG - Intronic
1002349590 5:178574541-178574563 CCCGGGAGCAACCTTTTCATTGG - Intronic
1003495055 6:6656483-6656505 CCAGGAAGCAGGGTTGTCAGGGG + Intergenic
1004656424 6:17666437-17666459 CCCGGAGGCAGAGCTTTCAATGG + Intronic
1007629997 6:43268167-43268189 CCAGGCAGAAGGATTTTCATAGG - Intronic
1011507231 6:88059068-88059090 TTCGGAAGGAAGGTTTTCATTGG + Intronic
1014068929 6:117159097-117159119 CCTGGAAGCAAGGTTTTGGTAGG + Intergenic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1017470200 6:154731883-154731905 ACAAGAAGCAGTGTTTTCATAGG - Intergenic
1018826582 6:167412301-167412323 CCCTGAAGCAGGTGATTCATTGG + Intergenic
1023741751 7:43287359-43287381 CCCCGAGGCAGGGTTGTGATGGG + Intronic
1029282517 7:99445244-99445266 CCCGCAAGATGGGTTATCATGGG - Intronic
1030249560 7:107427538-107427560 CTTGGAAGCAGGGTTTTCCCAGG + Intronic
1033882279 7:145900910-145900932 CCTGGAAGCAGACTTTTCACTGG - Intergenic
1037969195 8:23160165-23160187 CCAGGAAGCAGGATTCACATGGG + Intronic
1044299472 8:90567046-90567068 CCAGGTACCAGGGTCTTCATGGG - Intergenic
1046772851 8:118134174-118134196 CCCGGAAGCTGCCATTTCATTGG - Intergenic
1048003684 8:130400953-130400975 CCCGGAAGCAGAGGTTGCAGTGG - Intronic
1048512118 8:135072317-135072339 CCGGGGAGCAGGGTTTTATTTGG + Intergenic
1050061811 9:1717298-1717320 CACGAAAGCATGGTTTTCAAAGG - Intergenic
1052601245 9:30635208-30635230 CTGGGAAACAGGGTTTTCATTGG - Intergenic
1052829542 9:33203541-33203563 ACTGGAAGCTGGGTTTTGATGGG - Intergenic
1057936653 9:99245386-99245408 CCCGGGGGCAGGGCTTTCAAAGG - Intergenic
1060208697 9:121697889-121697911 CCCGGAAGCTGGGTGTCCTTGGG + Intronic
1062593986 9:137289262-137289284 GCTGGCAGGAGGGTTTTCATGGG + Intergenic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1196741853 X:119032129-119032151 CCAGGAAGCTGGGCTCTCATAGG - Intergenic
1197346166 X:125327307-125327329 CCTGGTAGCAGGGTTTGCAGAGG + Intergenic
1197911816 X:131491296-131491318 CCCAAAAGCAGGGTTTTGCTAGG - Intergenic