ID: 1186459837

View in Genome Browser
Species Human (GRCh38)
Location X:9739543-9739565
Sequence CCCGGAAGCAGGGTTTTCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186459831_1186459837 -7 Left 1186459831 X:9739527-9739549 CCACTTGAGACACCTTCCCGGAA 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459828_1186459837 -3 Left 1186459828 X:9739523-9739545 CCACCCACTTGAGACACCTTCCC 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459830_1186459837 -6 Left 1186459830 X:9739526-9739548 CCCACTTGAGACACCTTCCCGGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1186459827_1186459837 -2 Left 1186459827 X:9739522-9739544 CCCACCCACTTGAGACACCTTCC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186459837 Original CRISPR CCCGGAAGCAGGGTTTTCAT GGG Exonic