ID: 1186463350

View in Genome Browser
Species Human (GRCh38)
Location X:9765626-9765648
Sequence CGGGGACGTCGCGGGGGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186463336_1186463350 27 Left 1186463336 X:9765576-9765598 CCGAGAAGGTCGCAGGCAGCGGC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG 0: 1
1: 0
2: 2
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186463350 Original CRISPR CGGGGACGTCGCGGGGGACC CGG Exonic
900097037 1:944020-944042 CGTGGCCGTCGTGGGGGACAAGG - Exonic
900240598 1:1615659-1615681 CGGGGACGGTGCGGAGGACCAGG - Intronic
900649637 1:3724446-3724468 TGGGGACGTCGAAGGGGGCCTGG - Intronic
901766162 1:11501499-11501521 CGGGGATGACGCGGGGGGCTCGG - Exonic
903233963 1:21937552-21937574 ATGGGACGGGGCGGGGGACCGGG + Intergenic
905151572 1:35931579-35931601 CGGGGAGGTCGCGGAGGAGCAGG - Intronic
905422851 1:37859979-37860001 CGGGAACGTCGCGGCCGTCCAGG - Intergenic
905553045 1:38859372-38859394 CGGGGAGGGGGCGGGGGACTGGG + Intronic
908477776 1:64505875-64505897 CGGGGACGAAGCGGGGGACCCGG - Intronic
912539980 1:110407466-110407488 CGGGGACGTCGCGCGACCCCCGG - Intronic
915616987 1:157046206-157046228 CGGGGACGGCGCGCGGTGCCTGG - Intergenic
917846774 1:179026252-179026274 CGGGGACGGCTCAGGGCACCCGG - Intronic
923744412 1:236686838-236686860 CGGGAGCCCCGCGGGGGACCCGG - Intronic
1065124889 10:22564835-22564857 CAGGGAAATCGCTGGGGACCTGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070808854 10:79287174-79287196 CAGGGAGGTCACTGGGGACCCGG - Intronic
1071573759 10:86711610-86711632 CGGGGAGCCCGCGCGGGACCCGG + Intronic
1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG + Intergenic
1073491448 10:103855616-103855638 AGGGGACGGGGCGGGGGCCCCGG + Intergenic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1080601851 11:33828924-33828946 CGGGGACCTCGCGGGATCCCAGG - Intergenic
1082025109 11:47565815-47565837 CGGGGACGGGGCAGGGGCCCGGG - Intronic
1082807645 11:57460766-57460788 CGGGGACCCCGCGGGGCTCCGGG - Exonic
1083609688 11:63998958-63998980 CGGGGAAGTAGTGGGGGAGCCGG + Exonic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1085322586 11:75583837-75583859 AGGGGACGCCGCGGGAGACTGGG + Intergenic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1091498295 12:991213-991235 CGGTGACGTCGCGGGCGCCTGGG + Intronic
1092229070 12:6766816-6766838 CGGGGCCGTCGGGGGCGGCCTGG - Intronic
1096102414 12:48978039-48978061 AGGGGACGTCGGAGGGGCCCGGG + Intergenic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096675767 12:53224940-53224962 GGGGGACGTCACTGGGGACTGGG + Intronic
1102514914 12:113439946-113439968 AGAGGACGTCGCTGGGGGCCAGG - Intergenic
1102893007 12:116575898-116575920 CGGCGACGACGCGAGGGTCCCGG - Exonic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG + Intergenic
1105011944 12:132761911-132761933 CCGGGGCGGCGCGGGGGACACGG + Intergenic
1105476135 13:20729691-20729713 TGGGGATGTCGCAGGGGAGCTGG - Intronic
1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1112941778 13:104872222-104872244 GGGGGACGTGGCAGGGGACAAGG - Intergenic
1113579897 13:111421332-111421354 AGGGGATGTGACGGGGGACCGGG + Intergenic
1118285209 14:64465206-64465228 GGGGGAAGGCGGGGGGGACCAGG - Intronic
1122543304 14:102509500-102509522 CGGGCGCGGCGCGGGGGACGGGG + Intronic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122782630 14:104150120-104150142 GGGGGACGGGGAGGGGGACCAGG - Intronic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1125674364 15:41494451-41494473 CGGGGGCTGCACGGGGGACCTGG + Intronic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1130327066 15:82889661-82889683 GGGGCAAGCCGCGGGGGACCAGG + Intronic
1131059381 15:89395271-89395293 CTGGGACTTGGCAGGGGACCTGG + Intergenic
1132687772 16:1169453-1169475 GGGGAACGTCGCGGGGGCCGCGG - Intronic
1132934579 16:2474210-2474232 CGGGGACGGGGCGGCGGCCCAGG - Intergenic
1132968543 16:2673426-2673448 CGGGGGCATCGCGGGGGGCGGGG - Intergenic
1134022393 16:10930081-10930103 CGGGGACGTGCCAGGGGGCCAGG - Exonic
1136923439 16:34350500-34350522 CGGGGGAGTCGCGGGGCTCCTGG - Intergenic
1136981134 16:35061306-35061328 CGGGGGAGTCGCGGGGCTCCTGG + Intergenic
1139439571 16:66959273-66959295 TGGGGACGTGGGAGGGGACCAGG + Intergenic
1139506089 16:67398761-67398783 CGGGGACGTGACGGGTGACCAGG + Intronic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1141959032 16:87392380-87392402 CGGCGACGACGCGAGGGTCCCGG - Exonic
1142156231 16:88533920-88533942 CGAGGACGGCGCGGGCGGCCGGG + Exonic
1142338903 16:89508195-89508217 CGAGGAGGTCGCGGGTGCCCTGG - Intronic
1142623832 17:1180204-1180226 CGGGGGGGACGAGGGGGACCTGG - Intronic
1145041301 17:19579956-19579978 CGGGGAGCTCGGCGGGGACCGGG - Intergenic
1146888250 17:36486791-36486813 CGGGGAGGTCGCGGGGTCCAGGG + Intronic
1147044511 17:37743218-37743240 CGGGGAGGTCGCTCAGGACCTGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151370237 17:73643124-73643146 CGGGGACCTGCCCGGGGACCAGG + Intronic
1152222272 17:79075251-79075273 CGAGGACGGCGGGGCGGACCGGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1153226878 18:2906591-2906613 CGAGGACGCCGCGGGCCACCCGG - Intronic
1154125569 18:11689526-11689548 CGGGGGCGGCGCGCGGGACTAGG - Exonic
1158137624 18:54224300-54224322 CGGGGCCGTGGCCGGGGACGGGG - Exonic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160742846 19:695305-695327 CGGGGACTTGGCGGGGGCCTGGG + Intronic
1160987893 19:1848119-1848141 CGGGGACCCCGGGCGGGACCGGG + Intronic
1161171636 19:2815196-2815218 CTGGGACTTCGCTGGGGACCAGG - Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162145508 19:8610655-8610677 CGGCGACGGCGCGGAGGCCCCGG - Intronic
1162733775 19:12734538-12734560 CGGGGACGTCGCCCGAGAGCGGG - Exonic
1162760437 19:12885606-12885628 CGGGTACATCGCGGGGTACCCGG + Exonic
1163158938 19:15453448-15453470 TGGGGAGGTCCCGGGGGGCCAGG + Exonic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1165423151 19:35732268-35732290 CGGGAACGTCTGGGGGGAGCTGG - Exonic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1166996785 19:46723228-46723250 CGGGGACGCCGTGTGGGGCCTGG - Exonic
1167584432 19:50365613-50365635 TGGAGACATCGCTGGGGACCTGG + Exonic
1167611211 19:50508507-50508529 CGGGGATGTGGCTGGGGACAGGG - Intronic
925376156 2:3387857-3387879 CGAGGGCGACGCGGGCGACCTGG + Exonic
926054720 2:9767899-9767921 TGTGGACGTGGTGGGGGACCTGG - Intergenic
927751306 2:25673225-25673247 CGGGGAGGGCGCGGGGAGCCGGG - Intronic
929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG + Exonic
930700836 2:54456695-54456717 CGGGGGCGGCGCGGGGAGCCCGG + Intronic
931364446 2:61606664-61606686 CGGGGGGGTGGCGGGGGAGCGGG + Intergenic
937241749 2:120466382-120466404 CGGGGGCGTGGCTGGGGACCTGG + Intergenic
940883410 2:158968851-158968873 CGGAGAGGTCGAGAGGGACCCGG + Intronic
946416581 2:219543150-219543172 CGGGGAGGTCGCCCGGGCCCGGG - Intronic
946843065 2:223837132-223837154 TGGGGATGTCGCGGGGGACCAGG - Intronic
1171013776 20:21522502-21522524 TGGGGATGGCGCGGGGCACCCGG - Intergenic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1174317284 20:49713145-49713167 CGGGCGCGCCGCGGGGGACTGGG + Intronic
1175267632 20:57711985-57712007 CCGGGAAGTCTCGGGAGACCTGG + Intergenic
1175998612 20:62822135-62822157 CCGGGAGGTCCTGGGGGACCAGG - Exonic
1176005667 20:62861211-62861233 CGGGGACGGAGCGAGGGCCCGGG - Exonic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1179882588 21:44299824-44299846 CGAGGATGTGGCCGGGGACCAGG - Intergenic
1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG + Exonic
1182261188 22:29073650-29073672 GGGGGAAGTCGCTGGGGACTTGG - Intronic
1183324076 22:37182074-37182096 CAGGGAGGTCCCCGGGGACCTGG - Exonic
1183368666 22:37420151-37420173 CGGCGAGGTCGGGGGGGAGCAGG + Intronic
1184146527 22:42614702-42614724 CGGGAGCGACGCGGAGGACCGGG - Intronic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184727487 22:46355400-46355422 TGGGGACGCCGAGGGGCACCTGG - Intronic
1184796852 22:46737939-46737961 CGGGGGCGGCTTGGGGGACCCGG - Intronic
954059104 3:48055108-48055130 CGGGGACCACGTGGGGAACCTGG + Intronic
961081793 3:124033820-124033842 CGGGCAGGGCGCGGGGGGCCAGG + Intergenic
968048123 3:195635377-195635399 GGGGGAGGCCGCTGGGGACCCGG - Intergenic
968048195 3:195635531-195635553 GGGGGAGACCGCGGGGGACCCGG - Intergenic
968099209 3:195954089-195954111 GGGGGAGACCGCGGGGGACCCGG + Intergenic
968099279 3:195954243-195954265 GGGGGAGGCCGCTGGGGACCCGG + Intergenic
968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG + Intergenic
968306488 3:197654544-197654566 GGGGGAGGCCGCTGGGGACCCGG + Intergenic
968760043 4:2438019-2438041 AAGGGACGTCACGGGGCACCAGG - Intronic
979278093 4:118835839-118835861 CGGGGACGCGGCGGGAGGCCGGG - Intronic
980463970 4:133150786-133150808 GGGGGAGGTGGCGGGGGAGCAGG + Exonic
981920231 4:150078532-150078554 CGGGGGAGTCGCGCGGGCCCAGG - Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
1001600295 5:172924001-172924023 CGTGGAAGTTGCCGGGGACCTGG - Exonic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002132899 5:177092309-177092331 CGGGGACCGCTCTGGGGACCGGG - Exonic
1002597259 5:180332227-180332249 CGGGGAGGTGGCGGGGGGGCGGG + Intronic
1004044669 6:12012359-12012381 GGCGGACGGAGCGGGGGACCGGG + Exonic
1010142157 6:72623263-72623285 CGGGGAGGCAGCGGGGAACCTGG + Intronic
1020140191 7:5607596-5607618 CGGGGAGGATGCGGGGGAACAGG - Intergenic
1023435068 7:40134274-40134296 CTGGGACCCCGCGGGGGACCTGG + Exonic
1023842373 7:44104619-44104641 CGGGGAGGGCGCGGGGGGTCAGG - Exonic
1024195212 7:47052680-47052702 TGGGGACGTCGGGAGAGACCTGG - Intergenic
1026684052 7:72493149-72493171 CGGGGAGGTGGTGGGAGACCCGG - Intergenic
1029374873 7:100171508-100171530 CGGGGGCGTCGGGGGGCAGCAGG - Intronic
1029640854 7:101817720-101817742 CGGGGATGTCGGGGGGTGCCCGG + Intronic
1032344748 7:131107527-131107549 GGGGGACGGCGAGGGGGCCCCGG + Intergenic
1032534750 7:132653469-132653491 CTGGCACGTCGAGGGAGACCAGG - Intronic
1033406157 7:141073162-141073184 CGGAGGCGTCGCGGGAGAGCCGG + Intergenic
1034272050 7:149808108-149808130 CGTGAACTTCGCAGGGGACCTGG + Intergenic
1037815533 8:22109760-22109782 CGGTGACGTCACGGAGGCCCGGG + Intergenic
1047998548 8:130358473-130358495 CGGGGTCTTCGCGGGGGTCTGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049647075 8:143740272-143740294 CGGGCACGACGCGGCGGACCCGG - Intergenic
1060112060 9:120913552-120913574 CGTGGAAGTGGCGGGGGACCTGG - Exonic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060727400 9:126015673-126015695 AGAGGACGAGGCGGGGGACCGGG + Intergenic
1061908403 9:133710467-133710489 AGGGGGCGTCCCGGGAGACCAGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062022658 9:134326681-134326703 CGGGGACGGGGCCGGGGGCCGGG + Intronic
1062234347 9:135500831-135500853 CGGGGACGTGGAGGGGACCCGGG + Intronic
1062517518 9:136943900-136943922 GGGGCACGTCGCGGGCCACCTGG + Exonic
1062524855 9:136974080-136974102 CGGGGACGGCGCAGAGGACAGGG - Intergenic
1062638239 9:137502692-137502714 CGGGGGGGACGCGGGGGACGCGG + Intronic
1203785630 EBV:126007-126029 CGGGGACAGACCGGGGGACCTGG + Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1190041816 X:47078248-47078270 CGGGGACGGGGCGGGGTCCCAGG + Intergenic
1190214002 X:48468337-48468359 AGGGGGTGGCGCGGGGGACCGGG - Intronic
1190245091 X:48685683-48685705 TGGGAAAGTTGCGGGGGACCTGG + Intronic
1198602077 X:138294945-138294967 GGGGGACGGCGGGGGGGACAGGG - Intergenic