ID: 1186467750

View in Genome Browser
Species Human (GRCh38)
Location X:9797252-9797274
Sequence CTGGCTGCCTGGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186467740_1186467750 26 Left 1186467740 X:9797203-9797225 CCCTGGGGAGTGCAGCTGCAGCC 0: 1
1: 0
2: 1
3: 33
4: 382
Right 1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG 0: 1
1: 0
2: 3
3: 37
4: 341
1186467741_1186467750 25 Left 1186467741 X:9797204-9797226 CCTGGGGAGTGCAGCTGCAGCCA 0: 1
1: 0
2: 2
3: 29
4: 379
Right 1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG 0: 1
1: 0
2: 3
3: 37
4: 341
1186467744_1186467750 -4 Left 1186467744 X:9797233-9797255 CCATTTTACTTTTCCCCTTCTGG 0: 1
1: 0
2: 3
3: 59
4: 600
Right 1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG 0: 1
1: 0
2: 3
3: 37
4: 341
1186467743_1186467750 0 Left 1186467743 X:9797229-9797251 CCTGCCATTTTACTTTTCCCCTT 0: 1
1: 0
2: 5
3: 49
4: 480
Right 1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG 0: 1
1: 0
2: 3
3: 37
4: 341
1186467742_1186467750 5 Left 1186467742 X:9797224-9797246 CCATGCCTGCCATTTTACTTTTC 0: 1
1: 0
2: 7
3: 74
4: 773
Right 1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG 0: 1
1: 0
2: 3
3: 37
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186467750 Original CRISPR CTGGCTGCCTGGAATGAAGA TGG Intronic
900031834 1:378208-378230 CTGCCTGCCTGGATTGATGCAGG - Intergenic
900052382 1:606399-606421 CTGCCTGCCTGGATTGATGCAGG - Intergenic
900526637 1:3132510-3132532 CTGAGTCCCTGGAATGCAGAGGG + Intronic
900667038 1:3822538-3822560 TTCGCTGCCTGGCATAAAGAGGG + Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901663956 1:10815976-10815998 CTGGCAGCCTGGCATGCAAATGG + Intergenic
902466284 1:16620559-16620581 CTGGCTGTGAGGAATGAAGGGGG + Intergenic
902508396 1:16952744-16952766 CTGGCTGTGAGGAATGAAGGGGG - Intronic
902670483 1:17969934-17969956 CTGGAAGCCTGGGATGAAGTGGG - Intergenic
903758550 1:25681736-25681758 ATGGCTGGTTGGAATGAAAACGG - Intronic
904764400 1:32832524-32832546 CTGGGTTCCTGGAAGGCAGAAGG - Intronic
906144178 1:43550265-43550287 CCGGCGGCCTGGAAGGAGGAGGG - Intronic
906699588 1:47848297-47848319 CTGGCTGTGAGGAATGTAGATGG - Intronic
907118324 1:51989164-51989186 CCGGCTTCCTGGAATCCAGATGG - Intronic
907931397 1:59004237-59004259 CTGCCTGCCAGGAAGGGAGAGGG - Intergenic
908476680 1:64495555-64495577 CTGTCTGCCTGGATTGAAGTTGG + Intronic
910062446 1:83110144-83110166 CTGGCTTCCTGGTTTGCAGATGG - Intergenic
911943138 1:104072975-104072997 CTGGCTGCCCGTAACAAAGATGG - Intergenic
912941209 1:114046775-114046797 CTGTCTTCCTGGATTGCAGATGG - Intergenic
913098707 1:115543427-115543449 CCTGCTGGCTGGAATGCAGATGG - Intergenic
914897819 1:151692552-151692574 CTGCATGCCTGCACTGAAGAAGG + Exonic
915514731 1:156406171-156406193 CTGGCTGCCAGGACTCAAGGTGG + Intronic
915943753 1:160135419-160135441 ATGGCTCCCTGGAGGGAAGACGG - Exonic
916366947 1:164040125-164040147 CTGCCTGCCTGGCCTGAGGAAGG + Intergenic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916754210 1:167753232-167753254 CTGGCTGCGTGGCATGTTGAAGG + Intronic
917688252 1:177440247-177440269 GAAGCTGCCTGGAATTAAGACGG - Intergenic
919826939 1:201509792-201509814 ATGGCTGCTAGGAATGAAGTGGG + Intergenic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
922339126 1:224641412-224641434 CTGGGTGCCTGGGATGAAGAGGG - Intronic
922658225 1:227404704-227404726 CTGGCTGCATAGAATGAATTAGG - Intergenic
922672210 1:227519150-227519172 CTGGCTGCCTGCAATGAGGCTGG + Intergenic
924580662 1:245321166-245321188 CTGGCTGCCAGGGATGAGGGTGG - Intronic
924887395 1:248233974-248233996 CTGGCTCCCTTGGATAAAGAAGG + Intergenic
1063149889 10:3326812-3326834 ATGGCTGCTGGGAATGAAAATGG - Intergenic
1065149266 10:22805454-22805476 CTGCCTGGCTGGAATCAGGATGG + Intergenic
1065377257 10:25055878-25055900 CAGCCTGCCAGGTATGAAGAAGG + Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1069150166 10:64950398-64950420 CTGGCTTCATAGAATGAATAGGG + Intergenic
1069649882 10:70038589-70038611 CTTGTTGCCTGGAAGGAACATGG - Intergenic
1069800131 10:71076834-71076856 TTGGCAGCCTGGGATGAGGAGGG + Intergenic
1069855906 10:71440876-71440898 CTGGCTCCCTGGAGGGGAGAAGG - Intronic
1070456984 10:76626972-76626994 CTGGCTGCCTGGAAGGAGGTGGG + Intergenic
1070488600 10:76954375-76954397 CTGACTGACTGGCATGAGGATGG + Intronic
1070922923 10:80199988-80200010 CTTGCTGTCTGGAATGAGGAAGG + Intronic
1073776999 10:106797729-106797751 CTGGCTGCATGGACTGAAGGTGG - Intronic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1074909453 10:117894466-117894488 CTGGCTGCTTGGAATGAGAGGGG + Intergenic
1076076233 10:127535939-127535961 CTGGCTTCCTGGGAGGGAGAAGG - Intergenic
1076288024 10:129320438-129320460 GTGGCTGCCAGGAATGGGGATGG - Intergenic
1077198016 11:1291272-1291294 CGTCCTGCCTGGAATGCAGACGG + Intronic
1077332813 11:1990790-1990812 CTGGCTGCCTGGCTGGAAGATGG - Intergenic
1077488786 11:2850997-2851019 CTGGCTCCCTGGCCCGAAGATGG - Intergenic
1078069617 11:8099853-8099875 CTGAATGCCTGGCATGAAGAAGG + Intronic
1078293962 11:10046266-10046288 CTGGCCTCATAGAATGAAGAAGG - Intronic
1078448172 11:11420695-11420717 CTGGGTGCCAAGAATGAACAAGG + Intronic
1078499240 11:11853302-11853324 CATGCTGCCTGAACTGAAGAAGG - Intronic
1079325316 11:19486219-19486241 CTGGCTGCCCGGAAACAGGAAGG + Intronic
1079755110 11:24248922-24248944 GTGCCTGCCTGCAATGATGAGGG + Intergenic
1080666915 11:34344284-34344306 CTGGCTGCCTACAAAGAAGCTGG + Intronic
1080667195 11:34346083-34346105 CAGGCTGCCAGGAATGCTGAAGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083308346 11:61772241-61772263 CTACCTTCCTGGAATGCAGAGGG - Intronic
1083861018 11:65420039-65420061 CTGTCTGCCTGGGAAGAAGCAGG + Intergenic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1085264217 11:75227086-75227108 CTGGCTGCCTGGACAGCAGGTGG - Intergenic
1087881837 11:103425377-103425399 TTGGCTGCCTGCAATGTGGAAGG - Intronic
1089320996 11:117626693-117626715 GTGGGTGCCTGCAATGATGATGG - Intronic
1202815796 11_KI270721v1_random:45966-45988 CTGGCTGCCTGGCTGGAAGATGG - Intergenic
1092069834 12:5623567-5623589 CTGGCCCCCTGGGATGAAGCTGG - Intronic
1092154518 12:6273773-6273795 CTGGCTGACTGGAACCCAGAGGG + Intergenic
1093135647 12:15447096-15447118 GAGGCTGCCTGGAAAGAATAAGG + Intronic
1093416319 12:18925041-18925063 CTGGATGCCTGGAAGGACAAAGG + Intergenic
1096226106 12:49867820-49867842 CTCACTGCCTGGATTGGAGATGG + Exonic
1096665320 12:53160409-53160431 CTGGCTCCAGGGAAAGAAGAGGG - Intronic
1096973426 12:55684984-55685006 ATGGCTCCTTGGGATGAAGAGGG - Exonic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098469684 12:70828928-70828950 CCTGCTGCCTGGAATATAGAAGG - Intronic
1099904500 12:88756208-88756230 CTGGCTGCCTGCAATGAACGGGG + Intergenic
1103246459 12:119462077-119462099 CTGACTGCCTTGCCTGAAGAGGG + Intronic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1104741731 12:131181364-131181386 CTGGCTTCATGGAATGAATTAGG - Intergenic
1105654109 13:22416165-22416187 CTGGCTTCATGGAATGAGGTAGG - Intergenic
1107061660 13:36166088-36166110 CTGCCTGCCTGGATTTAGGAGGG + Intergenic
1107885064 13:44868178-44868200 CTGGCTTACGGGAATGAGGAAGG - Intergenic
1107900962 13:45013241-45013263 CAGGCTGCTTGGTATGATGAAGG - Intronic
1109626582 13:64982565-64982587 CTGCCTGCCGGCTATGAAGAGGG - Intergenic
1110816441 13:79865618-79865640 TTGGCTGCTTAGAATGAAGAGGG + Intergenic
1111069088 13:83138934-83138956 TTGGCTGCCTGAAATGAAATAGG + Intergenic
1111442188 13:88294196-88294218 CTGGCTGTCTGGTATGGATAGGG + Intergenic
1111461903 13:88556115-88556137 CTCACTTCCTGGCATGAAGATGG + Intergenic
1112576177 13:100638737-100638759 CCAGCTGGCTGGAATGGAGATGG + Intronic
1113345110 13:109469613-109469635 CTGGCTTCCTGGTATACAGATGG - Intergenic
1113959877 13:114120323-114120345 CTGGCTGGCTGGAGAGAGGAGGG - Intronic
1114883775 14:26821902-26821924 GTTGCTGCCTGGAATGAGGAAGG - Intergenic
1115296511 14:31833733-31833755 GTGGCTAGCTAGAATGAAGATGG - Intronic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117269013 14:54122172-54122194 CTCACTGCCTTGAATGAAGATGG + Intergenic
1118807909 14:69253756-69253778 CTGGATGCCTCGTGTGAAGATGG - Intergenic
1118890576 14:69905004-69905026 CGGGTTGCCTGTAATGAAGGGGG + Intronic
1119266021 14:73263739-73263761 CAGGCTGCCTGGCAGAAAGATGG + Exonic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1121794962 14:96727230-96727252 CTCTCTGACTGGAATGCAGAAGG - Intergenic
1122211989 14:100179231-100179253 CAGGCTGCCTGAGCTGAAGAGGG - Intergenic
1122630018 14:103103469-103103491 CTCTCTGCCTGGGATGAGGATGG + Intronic
1123101482 14:105804869-105804891 CTGTCTTCCTGGCTTGAAGATGG + Intergenic
1123130473 14:105981671-105981693 CTCGCTCCCTGGCATGCAGATGG + Intergenic
1202900137 14_GL000194v1_random:31168-31190 CTGGCTTCATAGAATGAATAAGG + Intergenic
1124372755 15:29112765-29112787 ATGGCTGCCTGACATGCAGATGG - Intronic
1124395229 15:29294913-29294935 CTTGGAGCCTGCAATGAAGAAGG - Intronic
1124621772 15:31278104-31278126 CTGGCTGCCTGGAGGGATGGTGG + Intergenic
1124907732 15:33886928-33886950 CTCGCTGCCTGGAATTTTGATGG - Intronic
1125579198 15:40773812-40773834 CTGGCTGTCCAGAATGAAGTTGG - Exonic
1125752369 15:42037224-42037246 CTGGCAGCCTGGCCTGAAGGTGG - Intronic
1128225923 15:66001303-66001325 CTGTCTGGCTGGTATGAGGAAGG + Intronic
1129276503 15:74449174-74449196 CTGGCACCCAGGTATGAAGACGG - Exonic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1131070598 15:89463311-89463333 CTGCCTGCCTGGAAGGGGGAAGG + Intergenic
1133353301 16:5117299-5117321 CAGGCTGCCTGGAAGGGAGGCGG + Intergenic
1133817736 16:9210981-9211003 CTGTGTGCCTGGCATGAAGTAGG + Intergenic
1134054788 16:11163140-11163162 CTGCCTGACTGGGATGAAGCAGG + Intronic
1134311680 16:13080897-13080919 CTGGCTTCCTGGTTTGCAGATGG + Intronic
1135903853 16:26492211-26492233 CTGGGTGCTTAGAATGAAGGAGG - Intergenic
1137635843 16:49985969-49985991 CTGCCTGCCTGGTATGGAGCAGG - Intergenic
1138249934 16:55494078-55494100 CTGGCTGGCTGGATGGATGATGG - Intronic
1138314648 16:56059439-56059461 GTGGTTGCCTGGGAGGAAGAAGG + Intergenic
1139012704 16:62652380-62652402 CTGGCTTAATGGAATGAAAATGG - Intergenic
1140112408 16:72015279-72015301 CTGGCTGCTGGGAATGCAGCTGG - Intronic
1140856888 16:78985882-78985904 CTGGCTGACGGGACTGCAGAAGG - Intronic
1141825002 16:86472597-86472619 CCTGCTGGCTGGAATGCAGATGG + Intergenic
1141989396 16:87601960-87601982 CAAGCTGCCCGGAAGGAAGAAGG + Intronic
1142141198 16:88473571-88473593 CTGGCTCCCTGGAAGGGAGCAGG - Intronic
1142356192 16:89603351-89603373 CTGACTGCCTGGGATGGGGAGGG - Intergenic
1142540556 17:655447-655469 CTGTCTGCCTGGAGTGAATATGG + Intronic
1142540562 17:655482-655504 CTGTCTGCCTGGAGTGCATATGG + Intronic
1142540567 17:655517-655539 CTGTCTGCCTGGAGTGAATATGG + Intronic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1148519815 17:48262101-48262123 GTGGCTGCCTACAAAGAAGATGG + Intronic
1149676922 17:58473021-58473043 CTGCCTGCCTCTCATGAAGAGGG - Intronic
1150285547 17:63951827-63951849 CTGGCAGCCTCGGATGAGGATGG - Exonic
1152404076 17:80086666-80086688 CAGGGTGCCTGGAATGATGGAGG + Intronic
1152947823 17:83207506-83207528 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1153128867 18:1831636-1831658 CTGGCTTCCTGGGATGCAGATGG - Intergenic
1153922206 18:9801877-9801899 CTGCCTGCAAGGAATGAAGCTGG - Intronic
1154076202 18:11204163-11204185 CTGGGAGACAGGAATGAAGAGGG + Intergenic
1156761034 18:40590752-40590774 CTGGCTGCCAGCAGTGAAGAAGG + Intergenic
1157472895 18:48003385-48003407 GGGGCTCCCTGGCATGAAGATGG - Intergenic
1157541152 18:48508621-48508643 CTGGCTTCATGGAATGAATTAGG - Intergenic
1159021720 18:63148639-63148661 CCTGCTGCCTGGAATGTAGTAGG + Intronic
1159834291 18:73318769-73318791 TTGAATGCCAGGAATGAAGAAGG - Intergenic
1159868167 18:73730405-73730427 CTTGCTGGCTGTAATGAAGGAGG + Intergenic
1160365839 18:78325247-78325269 CTGAGTTCCTGGAATGAAGGTGG - Intergenic
1160408159 18:78656855-78656877 CCGGATGCCTGGATTGAAGGGGG - Intergenic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1161661121 19:5546923-5546945 CTGGCTGCGTGGAAAGAACAGGG + Intergenic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1163761160 19:19137572-19137594 CAGGCTCCCGGGAATGAGGAGGG - Intronic
1163983370 19:20922614-20922636 CTGGGTGCCTGGAATGTGGCTGG + Intergenic
1164023652 19:21330843-21330865 CTGGCTGCCTGGAATGCGCCTGG - Intergenic
1164226547 19:23251146-23251168 CTGGGTGCCTGGAATGTCGCTGG - Intergenic
1164272779 19:23687853-23687875 CTGGGTGCCTGGAATGTGGCTGG - Intergenic
1164513167 19:28913603-28913625 CTGGCTGCCTATAGTTAAGAAGG - Intergenic
1202647345 1_KI270706v1_random:154500-154522 CTGGCTTCATAGAATGAATAAGG - Intergenic
926798364 2:16637460-16637482 CTGGCTTCCTGGCTTGCAGATGG - Intronic
927454456 2:23237674-23237696 CTGGCTGCCTGGCCCAAAGAGGG - Intergenic
927969525 2:27296587-27296609 CCTGCTGGCTGGAAAGAAGACGG - Intronic
928323934 2:30305092-30305114 CTGGCTGCCTAGTTTGCAGATGG + Intronic
928414956 2:31084427-31084449 CTGGCTGCCTGGTCCAAAGAAGG - Intronic
928856267 2:35806273-35806295 CTGGCTTCATAGAATGAAGTAGG - Intergenic
929094533 2:38250947-38250969 CTGCCTGCCTGGTATGACAATGG + Intergenic
930441070 2:51406682-51406704 TTGGCTGCATGGAATGAATTAGG + Intergenic
930965359 2:57317253-57317275 CTGGCTTCAGGGAATGAGGAAGG - Intergenic
932416085 2:71574671-71574693 CTGGCTGGCTGGTGTGAAGATGG + Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
932800731 2:74740403-74740425 CTGGCAGCCTGGAATATAGAGGG + Intergenic
933248208 2:79999314-79999336 GTGGCTAGATGGAATGAAGAAGG - Intronic
933298484 2:80517031-80517053 CTGTTTGTCTGAAATGAAGAAGG + Intronic
933456461 2:82525735-82525757 CTTGATGACTGGCATGAAGAAGG - Intergenic
936429962 2:112454138-112454160 CTGCCAGGCTAGAATGAAGAAGG - Intergenic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
939983153 2:148805104-148805126 CTGGCCTCATGGAATGAAGTGGG + Intergenic
940261894 2:151789751-151789773 CTTGCTGCCTGGAAGAATGACGG - Intronic
941131785 2:161659979-161660001 GTGGTTGCCTGGGGTGAAGAGGG + Intronic
941696126 2:168552728-168552750 CTGGCTGCCATGAAGGGAGATGG - Intronic
943473793 2:188329519-188329541 CTGGGTGGCTGAAATGAAGTGGG + Intronic
943890188 2:193276871-193276893 CTGGCTGTCCAGAATGAAGTTGG - Intergenic
944434464 2:199672177-199672199 AGGGCTGCCTGGGAGGAAGACGG - Intergenic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
945019483 2:205556881-205556903 CTGGCAGGCTGGAGTGAAAAAGG - Intronic
945025089 2:205612889-205612911 CTGGCTGCCTGGGAGGAGCAAGG + Intronic
945075446 2:206034234-206034256 CTGGCTTCATAGAATGAAGTAGG - Intronic
945910719 2:215646150-215646172 CTGGCTGCCTGGAAGGGTGGAGG + Intergenic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947543723 2:230995981-230996003 CTGGCAGCCTGGGATGAAGGAGG + Intergenic
1168976163 20:1967739-1967761 TTGGCTACCTAGAATAAAGATGG + Intergenic
1169460494 20:5790210-5790232 CAGGCTCCCTGGGAGGAAGAAGG - Intronic
1170434931 20:16316583-16316605 CTGAATGACTGGAATGAAGAAGG + Intronic
1170436761 20:16338367-16338389 ATGGCTGCCTGCAAGGAGGAGGG - Intronic
1172962821 20:38810492-38810514 CTTCCTGGGTGGAATGAAGAGGG - Intronic
1173065782 20:39709625-39709647 CCTGCTCTCTGGAATGAAGATGG + Intergenic
1173340734 20:42150449-42150471 CTGGCAGGCTGGACTGAACATGG - Intronic
1173539128 20:43838279-43838301 CTGGCTGCTTGGTCTGAGGAGGG + Intergenic
1174618465 20:51855145-51855167 GTGGTTGCCAGGAATGAAGGAGG - Intergenic
1175277996 20:57784915-57784937 CTGGCTGCCAAGCAAGAAGATGG + Intergenic
1175365095 20:58448016-58448038 CCGGCTGTCTGGCCTGAAGAAGG + Exonic
1176604519 21:8818272-8818294 CTGGCTTCATAGAATGAATAAGG + Intergenic
1176619510 21:9045946-9045968 CTGGCTTCATAGAATGAATAAGG + Intergenic
1178462932 21:32819211-32819233 CTGTCTGCCTGGATTGAGAAAGG - Intergenic
1178846044 21:36175023-36175045 CTCGCTGCCTGGCTTGGAGATGG + Intronic
1178985263 21:37297931-37297953 CTGGCCTCCAGCAATGAAGAAGG + Intergenic
1179453094 21:41478718-41478740 CCAGCTGCCTGGAATGGAGCAGG + Intronic
1179955396 21:44735455-44735477 CTGGCTGCCAGGGCTGGAGAGGG - Intergenic
1180346810 22:11709880-11709902 CTGGCTTCATAGAATGAATAAGG + Intergenic
1180354567 22:11827996-11828018 CTGGCTTCATAGAATGAATAAGG + Intergenic
1180383688 22:12164363-12164385 CTGGCTTCATAGAATGAATAAGG - Intergenic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1183048059 22:35237232-35237254 CTGGCTGCATAGAATGAATTAGG + Intergenic
1183272481 22:36870828-36870850 CTGGGTGCCTGGAAAGAATTGGG + Intronic
1183780572 22:39996080-39996102 CCAGCTGCCTGGAATGAATGGGG + Intronic
1184012214 22:41757667-41757689 CAGGCTGCCTGGCATGGGGAAGG - Intronic
1184282203 22:43443577-43443599 CTGGCAGCCTGGCATGAGGTGGG + Intronic
1184734292 22:46388966-46388988 CAGGCTGCATGGAAGGGAGAGGG + Intronic
1184867223 22:47208404-47208426 GTGGCTGCCTGGGACGGAGAGGG + Intergenic
1184955904 22:47885729-47885751 CTGCCTGCCTGGAATCACCAGGG - Intergenic
951199757 3:19863416-19863438 CTGGCTGCCTGGAAGAAAAGTGG - Intergenic
952493813 3:33898344-33898366 TTGGCTGCCTAGAATAAAAATGG - Intergenic
952639024 3:35569032-35569054 GTGGCTGCCTGAAATGAGGCAGG + Intergenic
953680322 3:45034149-45034171 CTGGCTGCCAGGAATGCTGCAGG - Intronic
959006617 3:101027047-101027069 CAGGCTGCCTAGAATGCAGCTGG - Intergenic
959459965 3:106613695-106613717 CTATCTGCCTGGAAGGAAAATGG + Intergenic
961140558 3:124552324-124552346 CTGTCTGCCAGGACTGGAGATGG - Intronic
961459704 3:127042646-127042668 CTGGCTGCCTGGAGTGAGGTTGG + Intergenic
962849729 3:139299383-139299405 CTGGCTGCCAGGCATGGAGCTGG + Intronic
964500997 3:157348018-157348040 GTGGCTAGGTGGAATGAAGATGG - Intronic
967559185 3:190898167-190898189 CTGGCTTCATGGAATGAATTAGG - Intergenic
968384287 4:122670-122692 CTGGGTACCTGGAATGTGGATGG + Intergenic
970879095 4:20906809-20906831 ATGGATGTATGGAATGAAGAAGG + Intronic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
971400762 4:26273506-26273528 CTAGCTGCCTGGAAGGAAACTGG + Intronic
972097064 4:35361231-35361253 CTGGCTTCATGGAATTAGGAAGG + Intergenic
973373601 4:49272667-49272689 CTGGCTTCATAGAATGAATAAGG - Intergenic
973387414 4:49522544-49522566 CTGGCTTCATAGAATGAATAAGG + Intergenic
973955520 4:56059502-56059524 CTGGCTGGGTGGAATGTGGATGG - Intergenic
974630454 4:64481039-64481061 GTGGCTGCCAGGAGTGAAGGAGG + Intergenic
975579559 4:75894525-75894547 CCGGGTGCCAGAAATGAAGACGG + Intronic
976008039 4:80454399-80454421 GTGACTGCCTGGATTGAACATGG + Intronic
976354083 4:84095257-84095279 GTGGCTGCCTGGGATGAGAATGG + Intergenic
976734168 4:88294124-88294146 CTTCCTCCCTGGAAGGAAGATGG - Intergenic
977945989 4:102914510-102914532 CCGACTGCCAGGAATGAACAAGG + Intronic
978298691 4:107239747-107239769 CTGGCTTTGTAGAATGAAGAAGG - Intronic
978571722 4:110145226-110145248 AGGGCTGGCAGGAATGAAGAAGG + Intronic
978655759 4:111063766-111063788 CAGCTTGCCTGGAATGAAGAAGG + Intergenic
978751098 4:112248796-112248818 CAGAATGGCTGGAATGAAGAAGG - Intronic
979035618 4:115712899-115712921 CTGTCTGCCAGGCAGGAAGATGG + Intergenic
980174296 4:129325877-129325899 CTGGCTGGCTGTAATGAAAGGGG + Intergenic
981041028 4:140221889-140221911 ATTGCTACTTGGAATGAAGATGG - Intergenic
983136378 4:164087650-164087672 CTGGGAACCTGGGATGAAGATGG - Intronic
983957038 4:173710080-173710102 CTGTGTGCCTGGAATGAGCAAGG + Intergenic
984521597 4:180808681-180808703 CTGGCAGCCAGTAATGAAGGAGG - Intergenic
984551225 4:181161425-181161447 CTGGCAGCCTGGACAGAGGAAGG - Intergenic
984978500 4:185254065-185254087 CTGGCTGCCTGGGAATTAGATGG + Intronic
985354171 4:189099444-189099466 TTGTCTTCCTGGAGTGAAGAAGG - Intergenic
985389325 4:189478659-189478681 CAGGCTGCCTGGAAAAAAGAGGG + Intergenic
986318619 5:6609399-6609421 TTGGCTGCAAGGAATGATGACGG - Intronic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
986975212 5:13386146-13386168 CTGGCTTCATAGAATGAATATGG - Intergenic
986981063 5:13448511-13448533 CAGGGTGCCTAGAATAAAGAAGG - Intergenic
987456798 5:18157556-18157578 CAGGCTTCCTGGAATGTGGATGG - Intergenic
988235497 5:28538200-28538222 CTGGCTGCATGAAATGAATTAGG + Intergenic
990712536 5:58601349-58601371 CTGGCTTCATAGAATGAAGTAGG + Intronic
990968193 5:61472211-61472233 GTGGCTGCCTAGAATAAAGGTGG + Intronic
991492284 5:67195051-67195073 CTCGCTCCCTGGCATGCAGATGG - Intronic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
995074108 5:107961061-107961083 CAGGCTGGCTGGAAAGAAGTGGG + Intronic
995525952 5:113050748-113050770 ATGGGTGCCAGAAATGAAGAGGG + Intronic
995618630 5:113997438-113997460 CTGGCTGCTTAGAAAAAAGAAGG + Intergenic
996235180 5:121119294-121119316 ATTACTGCCTGAAATGAAGAGGG + Intergenic
996552152 5:124742355-124742377 CTGGCTGCTTGGAATGTGGGAGG - Intronic
998205533 5:140154503-140154525 GTGGCTGCCTGGGAAGAAGCTGG - Intergenic
999113575 5:149142177-149142199 CGGGCTGCCTGGAAAGAGGAAGG + Intronic
999650541 5:153763152-153763174 CTGTCTGCCTAGAGTGAAAAGGG + Intronic
1000324071 5:160158745-160158767 CTGTCTGACTGTCATGAAGAGGG + Intergenic
1002086096 5:176776533-176776555 CAGGCTGACCGGAAAGAAGATGG - Intergenic
1002374985 5:178782257-178782279 GTGGATGCGTGGAATGAGGAAGG - Intergenic
1002741986 5:181440660-181440682 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1002939970 6:1707533-1707555 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002939990 6:1707595-1707617 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002940010 6:1707657-1707679 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1003579479 6:7326508-7326530 CTGCCTGCCTGGACAGAAAAAGG + Intronic
1003719813 6:8688841-8688863 TAGGCTGCCTGGAATTAAGGAGG - Intergenic
1005679924 6:28196788-28196810 CTTGCTCCTTGGTATGAAGAAGG + Intergenic
1006034417 6:31200352-31200374 CTGTCTGCCAGGCAGGAAGAGGG + Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1008119682 6:47597822-47597844 ATGGCTGTCTGGAATAAAGTTGG + Intronic
1008589645 6:52980921-52980943 CAGACTGACTGGAATGAAGCTGG + Intronic
1009495182 6:64337615-64337637 CTGGCTTCATGGAATGAATTAGG - Intronic
1014036619 6:116774003-116774025 CTTGCTGCCTGCAAAGAGGAAGG - Intergenic
1014815473 6:125931243-125931265 GTGGCTACAGGGAATGAAGAGGG - Exonic
1015398930 6:132767010-132767032 GTGGCTGCCAGAAGTGAAGATGG + Intergenic
1015849401 6:137556319-137556341 CTGGCTTCATGGAATGAATTAGG + Intergenic
1017270050 6:152493987-152494009 TTGGCTGCGTGTAATGAAAAGGG - Intronic
1017644309 6:156525001-156525023 CTCACTTCCTGGAAGGAAGAGGG + Intergenic
1018827030 6:167415941-167415963 CTGGACCCCTGGAAGGAAGAGGG - Intergenic
1019212576 6:170418534-170418556 CTGGCTGCCTGGAAGGCTGCTGG + Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1020278678 7:6638868-6638890 CTGGCAGGCTGGCAAGAAGAGGG + Intronic
1020466814 7:8489284-8489306 CAGACTCCCTAGAATGAAGAAGG - Intronic
1023214659 7:37848809-37848831 CTGCCTGTCTGGGAAGAAGAAGG - Exonic
1023829678 7:44031510-44031532 CTGTCTGCCTGGAAGGGAGCAGG + Intergenic
1025864969 7:65372873-65372895 CTGGCTGCCTGGAATGTGGCTGG + Intergenic
1025943972 7:66092534-66092556 CTGGGTGCCAGGGAGGAAGATGG - Intronic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1027699530 7:81452538-81452560 CTGGCTTCCTAGAATGAATTAGG - Intergenic
1027930570 7:84528842-84528864 CTTTCTGGCTGGAATCAAGAAGG - Intergenic
1028460218 7:91084293-91084315 CTGGCTGCATGAAATCTAGATGG - Intronic
1029339927 7:99934332-99934354 AAGGCTGCCAGGAATGAAAAGGG - Intergenic
1029380515 7:100211419-100211441 CTGACTGCTGGGAATGAAGCAGG - Exonic
1029739988 7:102485769-102485791 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1029757985 7:102584948-102584970 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1029775922 7:102684009-102684031 CTGTCTGCCTGGAATGGAGCAGG + Intergenic
1029853699 7:103491410-103491432 GTGGCAGCCTTGAATGAAAATGG + Intronic
1030166475 7:106560685-106560707 CTGGCTGGCTGAGGTGAAGAAGG + Intergenic
1032563548 7:132916960-132916982 GTGGATGCCTGAAATGCAGATGG - Intronic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033463170 7:141565687-141565709 CTGGATGCAGGGAATGAAGGAGG - Intronic
1033472799 7:141664766-141664788 CATGCTGCCTGGGATGGAGATGG - Intronic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035247797 7:157576240-157576262 CTGGCTGCATGGGATGAAAGAGG - Intronic
1035414732 7:158673435-158673457 CTGGCTGCCCGGGAAGAAGAAGG - Intronic
1035501014 8:91536-91558 CTGCCTGCCTGGATTGATGCAGG - Intergenic
1035680508 8:1484083-1484105 CTGGCTCCCAGGAAGGAAGCCGG - Intergenic
1037233040 8:16682984-16683006 CTGGCTGCCTCCATTGAAGTTGG - Intergenic
1037801118 8:22036580-22036602 GGGGCTGCCTGGTATGGAGAAGG + Intronic
1038252595 8:25919603-25919625 TTGGCTGCCTGGTATTGAGAAGG - Intronic
1038493212 8:27984369-27984391 CTGGCAGCCAGGAATGAAGATGG + Intronic
1039038114 8:33381751-33381773 CTGGCTGCCAGTGATTAAGATGG + Intronic
1039412869 8:37370084-37370106 CTAGATGCCTGAACTGAAGAGGG - Intergenic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1046508277 8:115164564-115164586 CTTGGAGCCTGGAATGAATATGG + Intergenic
1046717568 8:117584316-117584338 CTGGTTCCCTAGAAGGAAGAAGG + Intergenic
1047102856 8:121697439-121697461 CTGGCTGCCTAGAATGACTAAGG - Intergenic
1047406620 8:124590695-124590717 CTGGATGCCTGGAAGCCAGATGG + Intronic
1047476506 8:125237153-125237175 CCTGCTGCCTGGGATCAAGAGGG - Intronic
1047749200 8:127867214-127867236 CAGGCTGTCAGGAAGGAAGAAGG + Intergenic
1051605724 9:18916316-18916338 CTGTTTGCCTGGTCTGAAGAGGG + Intergenic
1051951834 9:22644537-22644559 CTGGCTTCCTGGTTTGCAGATGG + Intergenic
1052849593 9:33368886-33368908 CTGGCTCCCAGGAGTGGAGAGGG - Intronic
1056567723 9:87789625-87789647 CTGGGTGCCTGCAATGATTAAGG - Intergenic
1057118408 9:92547636-92547658 GTGGTTGCCTGAAATGAAGGGGG + Intronic
1057515415 9:95716355-95716377 ATGGCTGGCTGGAGTGAAGATGG - Intergenic
1060932037 9:127495301-127495323 CCGTCTGCCAGGAATGAAGCAGG - Exonic
1062367534 9:136218389-136218411 CTGGCTGCCTGGAGAGTAGATGG - Intronic
1062399634 9:136366723-136366745 CGGGCTGCCTGTGCTGAAGATGG + Intronic
1062725159 9:138068885-138068907 CTGGCTGCCTGCACTGCAGCAGG - Intronic
1203697304 Un_GL000214v1:110671-110693 CTGGCTTCATAGAATGAATAAGG - Intergenic
1203551908 Un_KI270743v1:170356-170378 CTGGCTTCATAGAATGAATAAGG + Intergenic
1203607898 Un_KI270748v1:71876-71898 CTGCCTGCCTGGATTGATGCAGG + Intergenic
1185943509 X:4347953-4347975 CTGGCTCTCTGGAAGGCAGATGG + Intergenic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187821589 X:23293491-23293513 CTGGCTGCCTGGAATTCATAGGG - Intergenic
1189160227 X:38803531-38803553 GTGGTTGCCGGGGATGAAGAGGG - Exonic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1189570515 X:42291010-42291032 GTGGCTGCATGGATGGAAGAGGG + Intergenic
1189676415 X:43465088-43465110 TTGGCTGCCTGGAATAAGCAGGG - Intergenic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1192197438 X:69038033-69038055 CAGGCTGCATGGAATGCAGATGG - Intergenic
1192238982 X:69314677-69314699 CTGGCTGCCTAGTATGGAAACGG - Intergenic
1193775127 X:85631853-85631875 CTGGCTTCCTAGAATGAACTAGG - Intergenic
1194960012 X:100224288-100224310 CTGACGCCCAGGAATGAAGAAGG - Intergenic
1195556662 X:106234719-106234741 CTGGCTTCATGGAATGAATTAGG - Intergenic
1195938292 X:110145657-110145679 CTTGCTGCCTGGAGTGAGGTAGG - Intronic
1196236008 X:113280960-113280982 CTCCCTGACTTGAATGAAGAAGG - Intergenic
1196883669 X:120223416-120223438 CTGGCCGCCTGGCCTGAAGGTGG + Intergenic
1197668780 X:129252734-129252756 CTGGCTGTATGGAATGAATTAGG + Intergenic
1199830060 X:151540260-151540282 CTTGCTGGCTGGAATGAAGGTGG + Intergenic
1200243668 X:154511397-154511419 CTGCCGGCCTGGAGTGAAGGGGG + Intronic
1201153177 Y:11105937-11105959 CTGGCTTCATAGAATGAATAAGG + Intergenic