ID: 1186467954

View in Genome Browser
Species Human (GRCh38)
Location X:9798949-9798971
Sequence TCTCACATGCTGATGCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186467953_1186467954 27 Left 1186467953 X:9798899-9798921 CCTGCTGCTGCTTCAATCATATT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186467954 Original CRISPR TCTCACATGCTGATGCCATT AGG Intronic
902640725 1:17764590-17764612 TCTCTCATCCTGATGCCTATTGG + Intronic
906893530 1:49744096-49744118 TCTCACTAGCTGATAACATTTGG + Intronic
908666197 1:66493868-66493890 TCCAACATACTGATTCCATTTGG + Intergenic
909964210 1:81887704-81887726 TGTCACATGCAGATGCATTTTGG + Intronic
910296357 1:85649745-85649767 TCTCAAATGCTGATGCCACTGGG + Intronic
913596583 1:120384725-120384747 TCTCTCACGCTGATGACATCTGG - Intergenic
914090687 1:144494257-144494279 TCTCTCACGCTGATGACATCTGG + Intergenic
914307920 1:146439958-146439980 TCTCTCACGCTGATGACATCTGG - Intergenic
914594189 1:149133175-149133197 TCTCTCACGCTGATGACATCTGG + Intergenic
918992737 1:191718849-191718871 TCTTACAAGCTGAAGCCCTTTGG - Intergenic
919026904 1:192183869-192183891 TCTCAAAAGCAGATGCTATTAGG - Intronic
919594330 1:199543278-199543300 TCTAACATCCAGAAGCCATTAGG + Intergenic
921331838 1:214046772-214046794 ATTCACCTGCTGATGACATTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1063865587 10:10361953-10361975 ACTCACATGCTGCTGCCACTGGG - Intergenic
1063978390 10:11434935-11434957 TCTCCCATGCTCAGGCCAGTTGG + Intergenic
1066260395 10:33724178-33724200 TCTCACATGCTGATATGGTTTGG - Intergenic
1074307635 10:112293615-112293637 TCTCACCTGCTTATGTCTTTGGG + Intronic
1074788315 10:116861510-116861532 TTTCACTTGCTGCTGCCATAGGG - Intronic
1079109290 11:17595296-17595318 TCTCTCTTGCTAATCCCATTCGG + Intronic
1080800811 11:35608707-35608729 TTTCACAGGCTGATCTCATTGGG - Intergenic
1081428962 11:42955200-42955222 TCTCCCTTGCTTATCCCATTAGG - Intergenic
1084569111 11:69949007-69949029 TCCCACCTGCTGCTGCCAGTGGG - Intergenic
1085788008 11:79471906-79471928 TCTCACTTGCTGGAGCCAGTGGG + Intergenic
1093288874 12:17298799-17298821 TCTCACATTCGGATCCCACTGGG - Intergenic
1096884426 12:54702098-54702120 TATGACATACTGATGCCATGGGG + Intergenic
1097141729 12:56908278-56908300 TCTCACCTGCTGCTGCCATGAGG + Intergenic
1097307420 12:58084975-58084997 GCTCACATGCAGAGGCCATATGG + Intergenic
1098993259 12:77089731-77089753 CCTCACAGGCTGGTTCCATTTGG + Intergenic
1099549943 12:84031421-84031443 TTTCACATGCTTATGGCATTGGG - Intergenic
1102484358 12:113246019-113246041 TCCCACATGCTGATGTCACAGGG - Intronic
1110513933 13:76386320-76386342 TTTCACATTTTGTTGCCATTTGG - Intergenic
1114160160 14:20156679-20156701 TCTCAAATGCTCATGTCACTTGG - Intergenic
1114163254 14:20192193-20192215 TCTCAGATGAAAATGCCATTTGG - Intergenic
1118226042 14:63900207-63900229 TCTCAAATCATGATGCCACTGGG - Intronic
1118746145 14:68774870-68774892 TACCACATGCTCATGCCCTTAGG - Intergenic
1122541402 14:102499650-102499672 CCTCACACGCAGATGCCAGTGGG - Exonic
1123127874 14:105962293-105962315 TGTCACATGCTGATGTGGTTTGG + Intergenic
1124505803 15:30272246-30272268 TCTCAACTCCTGATTCCATTTGG - Intergenic
1127256309 15:57296664-57296686 TCTCACATGCAGAAGGCAATGGG + Intronic
1129445256 15:75612525-75612547 TCTTAGATGCTGTTCCCATTAGG + Intronic
1129783724 15:78293253-78293275 TAGCCCATGATGATGCCATTTGG - Exonic
1130633156 15:85589774-85589796 GCTCACATGCTATTGCCAGTGGG - Intronic
1135923609 16:26673046-26673068 TCCTACAGGCTGATGCCTTTGGG + Intergenic
1137450435 16:48568980-48569002 CATCACATGCTTTTGCCATTTGG + Intronic
1142328816 16:89437089-89437111 ACACACAGGCTGATGCCGTTTGG - Intronic
1145000751 17:19302904-19302926 TCTCTCAGGCTGATGACACTCGG + Intronic
1149302498 17:55318141-55318163 TCCCAGTTGCTGATGCCATCTGG - Intronic
1151069132 17:71188310-71188332 TCTCCCATGCTGTAGACATTAGG - Intergenic
1151316094 17:73323718-73323740 TCTCACTGGCTGCTGCCATGGGG - Intergenic
1155171242 18:23268033-23268055 GCCCACATGCTGCAGCCATTTGG + Intronic
1157173141 18:45426529-45426551 ACACACATGCTGATCTCATTCGG - Intronic
1158289062 18:55918350-55918372 AATCACATGCTGATGCCAGAGGG + Intergenic
1158430782 18:57385347-57385369 TCTGACAAGCTGATCACATTAGG + Intergenic
1158563454 18:58534679-58534701 TGCCACATGCTGAAGCCACTTGG + Intronic
1159490329 18:69124749-69124771 TCTTACATTCTAATGGCATTTGG - Intergenic
1162076137 19:8188905-8188927 TCTCAACTGCTGTTGACATTTGG - Intronic
1163130431 19:15269171-15269193 GATCACTTGCTGATGCCAGTAGG - Intronic
1164222889 19:23212427-23212449 TCTCACATGTTGCTTCCAGTAGG - Intergenic
1165897865 19:39154280-39154302 TCTCCCACGCTGCTGGCATTTGG - Intronic
1166195899 19:41205829-41205851 CCACAAATGTTGATGCCATTAGG + Intronic
925056599 2:861658-861680 GGTCCCATGCTGGTGCCATTTGG - Intergenic
925605281 2:5654087-5654109 TCTCTCACGCTGATGACATCTGG - Intergenic
925943932 2:8843389-8843411 TCTCAAATGATGGTGACATTAGG + Intergenic
927223464 2:20737520-20737542 TTTCAAATGTTGATTCCATTGGG + Intronic
927767879 2:25829783-25829805 TCCCACTTGCTTGTGCCATTTGG - Intronic
928127723 2:28627879-28627901 TGTCACAGGCTGATACCAGTGGG - Intronic
930507526 2:52303166-52303188 TTTCACCTGTTGATGGCATTTGG + Intergenic
932399931 2:71473289-71473311 TTTCACTTGCTGCTGCCTTTGGG + Intronic
940515305 2:154677076-154677098 GTTCACATGTTGATGGCATTTGG + Intergenic
942957984 2:181796616-181796638 TCACACTTGCTGATGGCCTTGGG + Intergenic
944192442 2:197017952-197017974 ACTCACATGGAGATGTCATTAGG + Intronic
946179769 2:217942377-217942399 TCTCCAGTGCTGATCCCATTCGG + Intronic
946199655 2:218064420-218064442 TCTCCAGTGCTGATCCCATTCGG + Intronic
946526824 2:220529755-220529777 TCTAAAATGCTGAGGCCATTTGG + Intergenic
947376713 2:229503621-229503643 TCTCCCAGGCTGTGGCCATTGGG - Intronic
1169745755 20:8940914-8940936 TTTCTCATGCTGATGTCCTTTGG + Intronic
1170461749 20:16583760-16583782 TCTCATCTGCTGGTGCCAATAGG + Intergenic
1171355501 20:24542677-24542699 TGTCAGATGCTAATGCGATTGGG + Intronic
1175371888 20:58497709-58497731 TCACACATGCTGAGGCCCTGGGG + Intronic
1179813002 21:43884293-43884315 TCTCTCCTGCTGAGGGCATTTGG + Intronic
1182623933 22:31632347-31632369 TACCACATGCTGAGGCCCTTAGG - Intronic
1183086338 22:35489498-35489520 TCTCACAGGCTGATGAAATATGG - Intergenic
1183920269 22:41161262-41161284 TCTCACAAGCTCTTACCATTTGG + Intronic
1184881836 22:47310719-47310741 ATTCACCTGCTGATGTCATTTGG + Intergenic
949518853 3:4831424-4831446 TCTCACATACCGATGTCATTAGG - Intronic
949608176 3:5676902-5676924 TCTCACATGGTGACGGCATGAGG - Intergenic
949807313 3:7969898-7969920 TCTCCCATGCTTCAGCCATTGGG - Intergenic
951240208 3:20277614-20277636 TCTCACATGCTGCTGCACTGTGG - Intergenic
952305224 3:32139661-32139683 ACTCTCTTGCTGATGACATTTGG - Intronic
954414530 3:50386655-50386677 TCTCACCTCCTGGTGTCATTGGG + Intronic
957529291 3:81420320-81420342 TGTCAAATGCTTATGCCAATTGG - Intergenic
958076054 3:88679761-88679783 TGTCACATACTGAGACCATTTGG - Intergenic
959672471 3:108994922-108994944 TCTCACCTGGTGATGTAATTTGG + Intronic
960940477 3:122929829-122929851 TCTCACATGCCCATGGCATTAGG + Intronic
964155000 3:153574433-153574455 TCTCACCTGCTGATGATATAAGG - Intergenic
969164703 4:5297933-5297955 TCTTTGATGCTGATGACATTTGG + Intronic
972293874 4:37717811-37717833 TCACCCCTGCTGATGCCATATGG + Intergenic
972961595 4:44459882-44459904 TCTCAAATGCTGATTCCTTTAGG - Intergenic
975471384 4:74772955-74772977 TTTCACATGCTGGTGTCAGTTGG + Intronic
977807815 4:101323594-101323616 TCTCAGATGTTGAAACCATTAGG + Intronic
978144611 4:105357147-105357169 TTTTACATGCAGATGCTATTTGG - Intergenic
985822894 5:2172389-2172411 TCTCTCATGCGGTTGCCATGAGG - Intergenic
987655785 5:20804110-20804132 TTTCACAAGCAGATGCCATGTGG + Intergenic
988246879 5:28696569-28696591 ACACACATGTTGATGCTATTTGG + Intergenic
988767769 5:34399796-34399818 TTTCACAAGCAGATGCCATGTGG - Intergenic
989083961 5:37656091-37656113 TCTTTGATGCTGATGCCCTTTGG + Intronic
990015976 5:51063511-51063533 TCTCACTTGCTGATTCCCTTGGG - Intergenic
995302019 5:110595263-110595285 TCTTTGATGCTGATGCCTTTTGG - Intronic
995546158 5:113233673-113233695 TCTGACATGCTGTTGCCATCTGG - Intronic
996598522 5:125233154-125233176 TCTCTCGTGCAGCTGCCATTGGG - Intergenic
998202717 5:140138076-140138098 TGTGGCATTCTGATGCCATTTGG - Intergenic
998527100 5:142852602-142852624 TCTCGCATGTTGATGCATTTTGG + Intronic
1000083349 5:157867898-157867920 TGTCACATGCTTCTGGCATTGGG + Intergenic
1000529505 5:162401770-162401792 TCTCCCACGATGTTGCCATTTGG - Intergenic
1003957830 6:11180882-11180904 ACTCACCTGTTGATGACATTTGG + Intergenic
1005502113 6:26437789-26437811 TCTCACCTCTTGCTGCCATTAGG - Intergenic
1005803827 6:29454691-29454713 TCTCACCAGTTGATGACATTTGG - Intronic
1006809613 6:36811296-36811318 TCAGACATCGTGATGCCATTTGG - Intronic
1013929838 6:115517080-115517102 TCTTACATGCTGGTGGCCTTTGG - Intergenic
1014334362 6:120114195-120114217 TCTCACCTGTTGATGATATTTGG + Intergenic
1016578241 6:145596766-145596788 TCTCACATTCTGCTATCATTTGG + Intronic
1017513764 6:155137623-155137645 TGTCACCTGCTGAGGCCACTGGG + Intronic
1018979083 6:168588515-168588537 TCTCCAAAGCTGATGGCATTTGG - Intronic
1020430735 7:8113959-8113981 TCTCAAATCCTGATGCTGTTGGG - Exonic
1022222408 7:28326433-28326455 TCACACAAGCTCATGCCAATTGG + Intronic
1022787589 7:33653746-33653768 TCCAAGATGCTGATGCCACTCGG + Intergenic
1023269208 7:38442327-38442349 TCTCACTTGATGAAGCCACTAGG - Intronic
1025080808 7:55980873-55980895 TCTGCCATGTTGATGCCCTTGGG + Intronic
1030612517 7:111705355-111705377 TCTTTGATGCTGATGACATTTGG + Intergenic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1037162934 8:15794666-15794688 ACTCACATGCAGGTGTCATTGGG - Intergenic
1037178650 8:15976267-15976289 TCTCACAAGTTGAGGTCATTGGG + Intergenic
1037430843 8:18811699-18811721 TCTAACATGCTGCAGCCTTTGGG - Intronic
1039787910 8:40849875-40849897 GCACACTTGCTGATGGCATTTGG - Intronic
1047125833 8:121959445-121959467 TCTAACATGCTAATGCAAATAGG - Intergenic
1047126914 8:121972974-121972996 TCTCAGATGCCCATCCCATTAGG + Intergenic
1047408091 8:124601935-124601957 GTTCACACTCTGATGCCATTTGG - Intronic
1048636782 8:136305083-136305105 TCTCACATGATGAGGCCTTTAGG + Intergenic
1048768686 8:137871207-137871229 TCTCAGATTCTAAAGCCATTTGG + Intergenic
1050146425 9:2573003-2573025 TCTCACAGATTGATGCTATTAGG - Intergenic
1055299519 9:74868532-74868554 TCTCATTTGCTGGTGGCATTTGG - Intronic
1055715839 9:79117123-79117145 TCACACATGCTGATGGCTTTTGG - Intergenic
1057711360 9:97448370-97448392 TGTGACATAGTGATGCCATTGGG + Intronic
1057919839 9:99088017-99088039 TCTCACATGGAGATGGCATGAGG + Intergenic
1058419867 9:104823424-104823446 TTACACATGCTGCTACCATTGGG + Intronic
1058503508 9:105646640-105646662 TTTCACATGATGATGCCACAGGG + Intergenic
1061424301 9:130489578-130489600 TCTCACATGAGGATGGCAGTGGG - Intronic
1185754787 X:2644674-2644696 TCTCCCAAGCTGGTGCCCTTGGG - Intergenic
1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG + Intronic
1186812630 X:13205349-13205371 GCTCACATTCTGTTGCCATTGGG + Intergenic
1188163071 X:26826182-26826204 TCTCACATTATGATGAAATTTGG - Intergenic
1197270952 X:124424256-124424278 ATTCATATGCTGATGGCATTTGG + Intronic
1198764984 X:140071361-140071383 ATTCATATGCTGATGGCATTTGG - Intergenic
1199727823 X:150602390-150602412 TATCAAATGCTGAGTCCATTTGG + Intronic
1201312927 Y:12613019-12613041 TCTTTGATGCTGATGACATTTGG - Intergenic