ID: 1186469063

View in Genome Browser
Species Human (GRCh38)
Location X:9807153-9807175
Sequence GCCTCGAGTATGTCTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186469055_1186469063 19 Left 1186469055 X:9807111-9807133 CCACCCATTCTGTCTGGATTCAG No data
Right 1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG No data
1186469054_1186469063 20 Left 1186469054 X:9807110-9807132 CCCACCCATTCTGTCTGGATTCA No data
Right 1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG No data
1186469058_1186469063 15 Left 1186469058 X:9807115-9807137 CCATTCTGTCTGGATTCAGGAGC No data
Right 1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG No data
1186469060_1186469063 -7 Left 1186469060 X:9807137-9807159 CCTCATGAAGGTCCCTGCCTCGA No data
Right 1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG No data
1186469057_1186469063 16 Left 1186469057 X:9807114-9807136 CCCATTCTGTCTGGATTCAGGAG No data
Right 1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186469063 Original CRISPR GCCTCGAGTATGTCTGAGCC TGG Intronic