ID: 1186470333

View in Genome Browser
Species Human (GRCh38)
Location X:9816518-9816540
Sequence CCTGGTCACCGGCATCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186470327_1186470333 23 Left 1186470327 X:9816472-9816494 CCGACAGAGGTGGTCAGCATGTC No data
Right 1186470333 X:9816518-9816540 CCTGGTCACCGGCATCCTTGTGG No data
1186470330_1186470333 -7 Left 1186470330 X:9816502-9816524 CCTTCAGGAAGACATGCCTGGTC 0: 1
1: 0
2: 4
3: 22
4: 242
Right 1186470333 X:9816518-9816540 CCTGGTCACCGGCATCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186470333 Original CRISPR CCTGGTCACCGGCATCCTTG TGG Intronic