ID: 1186471061

View in Genome Browser
Species Human (GRCh38)
Location X:9822520-9822542
Sequence CAGTATCCGCATCTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186471052_1186471061 27 Left 1186471052 X:9822470-9822492 CCAGCAGTGATAGAGAAAAGTTA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186471061 Original CRISPR CAGTATCCGCATCTGGTGCA GGG Intronic
901499246 1:9641422-9641444 CAGTTTCCCCATCTGGCACAAGG - Intergenic
902406809 1:16188823-16188845 CAGTTTCCTCATCTGGTAAACGG - Intergenic
902599060 1:17528816-17528838 CAGTGTGCTCATCTGTTGCATGG + Intergenic
903025436 1:20426860-20426882 CAGTTTCCTCATCTGTAGCACGG - Intergenic
905004787 1:34700887-34700909 CAGTGTCCTCATCTGTTGGATGG - Intergenic
905474482 1:38216476-38216498 CAGTTTCCTCATCTGTTACATGG + Intergenic
905615950 1:39398889-39398911 CAGTACTCCCAGCTGGTGCAAGG - Intronic
908583195 1:65539854-65539876 CAGTATCCTGGTATGGTGCAGGG + Intronic
910110060 1:83673355-83673377 CAGAATCCTCATGTGGTGCAAGG + Intergenic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
911883191 1:103267584-103267606 CAGTATCTGCTTCTGCAGCAGGG - Intergenic
915369767 1:155338858-155338880 CAGTCTCCTCATCTGTTGAATGG - Intronic
919125027 1:193382987-193383009 CAGTATGTGCTTCTGGTGCCAGG + Intergenic
921361056 1:214331442-214331464 CTGTTTCCTCATCTGCTGCATGG - Intronic
923694031 1:236228764-236228786 CAGTTTCCTCATCTGGAGCGTGG - Intronic
924258518 1:242206251-242206273 CACTTTCCGCCTCTGGTGCTGGG - Intronic
924776015 1:247114800-247114822 CAGTCTCCCCATCTGCAGCATGG - Intergenic
1064133813 10:12732924-12732946 CAGTTTCCTCATCTGTTGAATGG + Intronic
1064177933 10:13091395-13091417 CAGTGTCCTCATGTGGTGGAAGG - Intronic
1064494854 10:15898632-15898654 TAGTAATCGCATCTGGTACATGG + Intergenic
1070742134 10:78910145-78910167 CAGTTTCCACATCTGGTAAAGGG + Intergenic
1074187206 10:111107534-111107556 CAGTTTCCTCATCTGGTGGATGG + Intergenic
1075183515 10:120233530-120233552 AAGTATGGGCATCTGGTGGATGG + Intergenic
1075658688 10:124178381-124178403 CAGAATCCCCAGGTGGTGCAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077301453 11:1849054-1849076 CTGTCTCCAAATCTGGTGCAGGG - Intergenic
1080273658 11:30478632-30478654 CAGTATCCCCATCTTGTTCCTGG + Intronic
1085296473 11:75434447-75434469 CGGTATCCTCATATGGTGGATGG - Intergenic
1090478983 11:127051137-127051159 CAGTTTCCGCATCTGTAACATGG - Intergenic
1091390337 12:122316-122338 CAGTCTCCTCATCTGTTCCACGG - Intronic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1102528893 12:113531888-113531910 CAGTTTCCTCATCTGGTAAATGG - Intergenic
1102581105 12:113888609-113888631 CAGTTTCCTCATCTGTTGAATGG - Intronic
1102760655 12:115381963-115381985 CAGTGTCCTAATCTGGTGAATGG + Intergenic
1103526947 12:121575451-121575473 CAGTCTCCTGATCTGGAGCAAGG + Intronic
1103946934 12:124532078-124532100 CAGTTTCCTCATCTGGAGAATGG + Intronic
1106005835 13:25769536-25769558 CAGCTTCTGCATCTGCTGCATGG + Intronic
1107449206 13:40493216-40493238 CATTATCACCATCTTGTGCAGGG + Intergenic
1109935518 13:69278305-69278327 CAGCATCCTCATATGGTGTAAGG - Intergenic
1112034402 13:95483979-95484001 CTGTATCCTCATGTGGTGGAAGG - Intronic
1114645608 14:24254499-24254521 CAGTTTCCTCATCTGTAGCATGG - Intronic
1115389278 14:32836316-32836338 CTGCATCCTCATCTGGTGGAAGG + Exonic
1119603729 14:75996326-75996348 CAGTTTCCTCATCTGTTGAATGG + Intronic
1121691133 14:95877558-95877580 CAGTTTCCTCATCTGGGCCAAGG - Intergenic
1122087175 14:99316185-99316207 CAGTTTCCTCATCTGGATCAGGG - Intergenic
1122289100 14:100670184-100670206 CAGTTTCCCCATCTGCAGCATGG + Intergenic
1126421354 15:48476531-48476553 CAGTTTCCCCATCTGGTGATTGG + Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1128336705 15:66791030-66791052 CAGTATCTCCCTTTGGTGCACGG + Intergenic
1128672487 15:69585056-69585078 CAGTTTTCTCATCTGTTGCATGG + Intergenic
1134055020 16:11164585-11164607 CAGTGTGCCCATCTGGTGCAGGG - Intronic
1135664168 16:24322018-24322040 CAGTTTCCTCATCTGGTACACGG - Intronic
1135804397 16:25529024-25529046 CTGTGTCCTCATATGGTGCAGGG + Intergenic
1138169641 16:54836657-54836679 GACTCTCAGCATCTGGTGCAAGG + Intergenic
1139116303 16:63957998-63958020 CAGTATATGAATCTGGGGCAGGG + Intergenic
1139462627 16:67134717-67134739 CCGTATCCTCATATGGTGCAAGG + Intronic
1140317896 16:73917110-73917132 GTGTGTCTGCATCTGGTGCAGGG - Intergenic
1143128078 17:4657150-4657172 TAGTATCGGCTTCTAGTGCATGG - Intergenic
1143706015 17:8698149-8698171 CAGCATCCACACCTGATGCATGG + Intergenic
1143991496 17:10967200-10967222 CTGCATCCGCATGTGGTGGAAGG - Intergenic
1145250130 17:21292937-21292959 CAGTTTCCCCATCTGCAGCATGG + Intronic
1146935534 17:36810501-36810523 CAGTGTCCTCATCTGGAACATGG + Intergenic
1148991487 17:51670332-51670354 CAGTTTCCCCATCTGGTAAATGG - Intronic
1151978350 17:77494929-77494951 CAGTATCCGCCTGTGGTGTCAGG + Intronic
1153675514 18:7453032-7453054 CAGTATCCAGATCTCCTGCAGGG - Intergenic
1154030833 18:10752773-10752795 CAGGATCAGCATCTTTTGCATGG - Exonic
1157137884 18:45075163-45075185 CTGTATCCTCATGTGGTGGAAGG + Intergenic
1157227712 18:45882370-45882392 AAATATCCTCATCTGGTTCAAGG + Exonic
1160946963 19:1648183-1648205 CTTTATACGCATCTGGTCCAGGG + Intronic
1161268897 19:3378605-3378627 CAGTTTCCTCATCTGTAGCATGG + Intronic
1161699129 19:5785375-5785397 CTGGATCCGCATCAGGTGCCTGG - Exonic
1162184096 19:8891319-8891341 CAGTATCTCCATCTGGAGCTGGG + Intronic
1162831681 19:13288567-13288589 CAGTATCCTCATCTGGATAATGG - Intronic
1162894911 19:13759387-13759409 CAGTTTCCCCATCTGCTACATGG + Intronic
1162911648 19:13850985-13851007 CAATTTCCGCATCTGTTACAGGG + Intergenic
1163727054 19:18928806-18928828 CAGTTTCCTCATCTGGAGAATGG + Intronic
1165308811 19:35018627-35018649 CAGTCTCCCCATCTGGTCCAGGG - Intronic
1165314363 19:35045698-35045720 CAGCATCCTCATCTGGCCCAGGG - Intronic
1165314378 19:35045767-35045789 CAGCATCCTCATCTGGCCCACGG - Intronic
1165412310 19:35669739-35669761 CAGTTTCCTCATCTGGTAAATGG - Intronic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1165748898 19:38248144-38248166 CAGTATCCTCATCTGGAAAATGG - Intronic
1166055542 19:40285894-40285916 CAGTATCCACATCTGCTAAATGG + Intergenic
926291043 2:11530732-11530754 CAGAACCTGCATGTGGTGCATGG + Intergenic
929304358 2:40343958-40343980 CAGTACCCGCATCAGGTACAGGG + Intronic
930013747 2:46956963-46956985 CAGCAGCCGCATCTGATACAGGG - Exonic
930090303 2:47526993-47527015 CAGTTTCTGCATCTGTTGAATGG - Intronic
930607488 2:53507638-53507660 CAGTAGCCCCATCTGGAGTATGG + Intergenic
930828558 2:55718761-55718783 CAGTTTCAGAATGTGGTGCAAGG + Intergenic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
933227722 2:79769908-79769930 CAGTAGCCACATTTGGTGAATGG - Intronic
934678571 2:96266464-96266486 GAGAATCCGCATCTGGGGCACGG + Exonic
937124522 2:119464959-119464981 CAGTGTCCTCCTCTGCTGCAGGG + Intronic
938178882 2:129162081-129162103 CAGCATCCTCATCTGGAGAATGG - Intergenic
938199543 2:129361857-129361879 CAGGAGCCTCAGCTGGTGCATGG + Intergenic
944474521 2:200090026-200090048 CAGTCTCGGCAACTAGTGCATGG - Intergenic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
948905081 2:240976078-240976100 CAGTCTCCCCATCTGGGGCATGG - Intronic
1168999240 20:2155165-2155187 CAGTATTGTCATCTGGTGCATGG - Intronic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1171437679 20:25135802-25135824 CCGCATCCTCATCTGGTGCCGGG + Intergenic
1172649671 20:36493723-36493745 CAGCAGCCGCATCTGCTCCACGG - Intronic
1175915295 20:62423221-62423243 CAGTTTCCCCATCTGGAGCGAGG - Intronic
1176076422 20:63250395-63250417 CAGTTTCCTCATCTGGAGAATGG + Intronic
1183379655 22:37484574-37484596 CAGTTTCCTCATCCGGGGCAAGG + Intronic
1184093021 22:42302196-42302218 CAGTTTCCCCATCTGGAGAAGGG - Intronic
1184693384 22:46127462-46127484 CAGTATCCGCATCTGTCCAATGG - Intergenic
951255806 3:20448005-20448027 CAGTTTCTCAATCTGGTGCAAGG + Intergenic
952177977 3:30887491-30887513 CAGTATCCCAAGGTGGTGCAGGG - Intronic
953393619 3:42548978-42549000 CAGTTTCCTCATCTGGTAAATGG - Intronic
954436476 3:50498946-50498968 CAGTCTCCCCATCTGGAGGATGG + Intronic
954680338 3:52342594-52342616 CAGTTTCAGGATCAGGTGCAGGG + Intronic
956101514 3:65773031-65773053 CAGTTTCCTCATCTGGTAAATGG + Intronic
958789227 3:98631489-98631511 CAGTATCGGCTTCTGAAGCAGGG + Intergenic
964291478 3:155185691-155185713 CTGTATCCTCATCTGGGTCAGGG - Intergenic
965441376 3:168719294-168719316 CTGTATCCCCATATGGTGGAAGG - Intergenic
967989766 3:195122120-195122142 CAGTCTCCTCATATGGTGAAGGG + Intronic
972871529 4:43305884-43305906 CTGTATCAGCATCTGCTGGAGGG + Intergenic
977626987 4:99198227-99198249 CAGTATCTGCTTCTGATGCCTGG + Intergenic
977722525 4:100256684-100256706 CAAGATCTGCTTCTGGTGCAAGG + Intergenic
979607826 4:122657740-122657762 CAGTTTCCTCATCTGGAGAATGG + Intergenic
980957391 4:139443486-139443508 CAGTATCTGCTTCTGGAGCGAGG - Intergenic
985195890 4:187429008-187429030 CAGCATCCGCTTCTGGTGAGGGG + Intergenic
991302754 5:65145061-65145083 CTGGATCTGCATCTGGGGCAAGG - Intergenic
992862987 5:80930754-80930776 CTGTGTCCTCATCTGGTGGAAGG + Intergenic
995126492 5:108581877-108581899 CAGTGTCCTCATGTGGTGGAAGG + Intergenic
995279455 5:110316814-110316836 CAGTATCCGCTTCTGAAGCCAGG + Intronic
997989840 5:138535293-138535315 CAGTTTCCCCATCTGCTTCATGG - Intronic
998088285 5:139344941-139344963 CGGTTTCCTCATCTGTTGCATGG - Intronic
999207903 5:149863277-149863299 GAGTATGTGCCTCTGGTGCAAGG + Intronic
999762318 5:154712274-154712296 CAGTTTCCACATCTGTAGCATGG - Intergenic
1000223676 5:159237512-159237534 CAGTATCTGCTTCTGGAGCCAGG + Intergenic
1000351033 5:160353129-160353151 CAGTATCCTCATCTGTAACATGG + Intronic
1006921634 6:37631483-37631505 CAGTTTCCCCATCTGGAACATGG + Exonic
1007364068 6:41378050-41378072 CAGTATCCTTATCTGGAGTATGG + Intergenic
1008010159 6:46457942-46457964 CAGTATCCCCATATAGTCCAAGG + Intronic
1013016097 6:106161705-106161727 CAGTAGCCACATCTCGTTCACGG - Intergenic
1013784302 6:113762738-113762760 CAATATCAGCATCAGCTGCAGGG - Intergenic
1019118519 6:169784873-169784895 CAGAAGCCTCATCTGCTGCAAGG - Intergenic
1024683660 7:51720468-51720490 CAGATTCAGCATCTGGTTCAGGG - Intergenic
1032446128 7:131985130-131985152 CAGTCTCTGCCCCTGGTGCAGGG + Intergenic
1034627514 7:152504728-152504750 CAGGGTCTGCATCTGGTGCCAGG - Intergenic
1038328222 8:26588392-26588414 CTGTATTCGAATCTGGTGCTTGG + Intronic
1038516936 8:28195374-28195396 GAGTGTCTGCAGCTGGTGCAGGG - Intergenic
1039597234 8:38801381-38801403 CAGTTTCTGCATATGGTGTAAGG + Intronic
1041475311 8:58258941-58258963 CAGTTTCCTCAGCTGCTGCATGG + Intergenic
1043158381 8:76815446-76815468 CAGTATCCTCACATGGTGGAAGG + Intronic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1048885850 8:138908999-138909021 CAGTTTCCTCATCTGGTGACTGG - Intronic
1050109565 9:2200538-2200560 CAGTATCCTGATGTGGGGCAGGG + Intergenic
1050159249 9:2699966-2699988 CAGTTTCCTCATCTGATGAAAGG - Intergenic
1050796601 9:9553437-9553459 CAGTATCCTCATCTGTTAAATGG - Intronic
1057443090 9:95096106-95096128 CAGCGTCGGCATCTGGAGCATGG - Intergenic
1058757243 9:108094382-108094404 CAGTCTCCTCATCTGTTGGATGG - Intergenic
1059413464 9:114148938-114148960 CAGTGTCCGCCCCTGTTGCAGGG + Intergenic
1059472446 9:114516255-114516277 CAGTTTCCTCATCTGTTGAATGG - Intergenic
1059586661 9:115614639-115614661 CAGTATCTGCATCTATTGAATGG + Intergenic
1062393603 9:136343676-136343698 CAGTGTCCCCATCTGGGGAACGG + Intronic
1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG + Intronic
1187174827 X:16886891-16886913 CACTACCCACATCTGGTGCCAGG + Intergenic
1187747572 X:22426360-22426382 CAGTATCTGCATCTGATGAGGGG + Intergenic
1188870714 X:35367588-35367610 CAGTTTCCTCACCTGCTGCATGG + Intergenic
1192233799 X:69283791-69283813 CAGTTTCCTCATCTGGAGAATGG + Intergenic
1194513786 X:94825160-94825182 CAGTATCTGCTTCTGATGCCAGG + Intergenic
1198933626 X:141884890-141884912 CAGTATCTGCTTCTGGAGCCAGG - Intronic
1198953119 X:142095800-142095822 CAGTATGCTCATCTGTTCCAAGG - Intergenic
1200828463 Y:7667090-7667112 CAGCATCCACATCTGGTGAGAGG + Intergenic
1201410085 Y:13690900-13690922 CAGTATCCCTATCTCCTGCAAGG + Intergenic